Summary information and primary citation

PDB-id
2m6w
Class
DNA
Method
NMR
Summary
Solution NMR structure of the d(ggggttggggttttggggaagggg) quadruplex in sodium conditions
Reference
Dvorkin SA, Karsisiotis AI, Webba da Silva M (2018): "Encoding canonical DNA quadruplex structure." Sci Adv, 4, eaat3007. doi: 10.1126/sciadv.aat3007.
Abstract
The main challenge in DNA quadruplex design is to encode a three-dimensional structure into the primary sequence, despite its multiple, repetitive guanine segments. We identify and detail structural elements describing all 14 feasible canonical quadruplex scaffolds and demonstrate their use in control of design. This work outlines a new roadmap for implementation of targeted design of quadruplexes for material, biotechnological, and therapeutic applications.
G4 notes
4 G-tetrads, 1 G4 helix, 1 G4 stem, UDDU, anti-parallel:basket, 2+2, 4(-LwD+Ln)

Cartoon-block schematics in six views (download the tarball)

PyMOL session file

Download PDB file

View in 3Dmol.js

List of 4 G-tetrads

 1 glyco-bond=s--s sugar=---- groove=w-n- planarity=0.146 type=planar N- nts=4 GGGG A.DG1,A.DG10,A.DG24,A.DG15
 2 glyco-bond=-ss- sugar=---- groove=w-n- planarity=0.209 type=other  N+ nts=4 GGGG A.DG2,A.DG9,A.DG23,A.DG16
 3 glyco-bond=s--s sugar=-3-. groove=w-n- planarity=0.260 type=other  N- nts=4 GGGG A.DG3,A.DG8,A.DG22,A.DG17
 4 glyco-bond=-ss- sugar=3--. groove=w-n- planarity=0.222 type=other  N+ nts=4 GGGG A.DG4,A.DG7,A.DG21,A.DG18

List of 1 G4-helix

In DSSR, a G4-helix is defined by stacking interactions of G-tetrads, regardless of backbone connectivity, and may contain more than one G4-stem.

Helix#1, 4 G-tetrads, INTRA-molecular, with 1 stem
 1  glyco-bond=s--s sugar=---- groove=w-n- Major-->WC N- nts=4 GGGG A.DG1,A.DG10,A.DG24,A.DG15
 2  glyco-bond=-ss- sugar=---- groove=w-n- WC-->Major N+ nts=4 GGGG A.DG2,A.DG9,A.DG23,A.DG16
 3  glyco-bond=s--s sugar=-3-. groove=w-n- Major-->WC N- nts=4 GGGG A.DG3,A.DG8,A.DG22,A.DG17
 4  glyco-bond=-ss- sugar=3--. groove=w-n- WC-->Major N+ nts=4 GGGG A.DG4,A.DG7,A.DG21,A.DG18
  step#1  mm(<>,outward)  area=9.79  rise=3.06 twist=24.9
  step#2  pp(><,inward)   area=13.88 rise=3.39 twist=30.2
  step#3  mm(<>,outward)  area=17.43 rise=3.05 twist=13.8
  strand#1 DNA glyco-bond=s-s- sugar=---3 nts=4 GGGG A.DG1,A.DG2,A.DG3,A.DG4
  strand#2 DNA glyco-bond=-s-s sugar=--3- nts=4 GGGG A.DG10,A.DG9,A.DG8,A.DG7
  strand#3 DNA glyco-bond=-s-s sugar=---- nts=4 GGGG A.DG24,A.DG23,A.DG22,A.DG21
  strand#4 DNA glyco-bond=s-s- sugar=--.. nts=4 GGGG A.DG15,A.DG16,A.DG17,A.DG18

Download PDB file
Interactive view in 3Dmol.js

3 stacking diagrams
 1  glyco-bond=s--s sugar=---- groove=w-n- Major-->WC N- nts=4 GGGG A.DG1,A.DG10,A.DG24,A.DG15
2 glyco-bond=-ss- sugar=---- groove=w-n- WC-->Major N+ nts=4 GGGG A.DG2,A.DG9,A.DG23,A.DG16
step#1 mm(<>,outward) area=9.79 rise=3.06 twist=24.9

Download PDB file
Interactive view in 3Dmol.js

 2  glyco-bond=-ss- sugar=---- groove=w-n- WC-->Major N+ nts=4 GGGG A.DG2,A.DG9,A.DG23,A.DG16
3 glyco-bond=s--s sugar=-3-. groove=w-n- Major-->WC N- nts=4 GGGG A.DG3,A.DG8,A.DG22,A.DG17
step#2 pp(><,inward) area=13.88 rise=3.39 twist=30.2

Download PDB file
Interactive view in 3Dmol.js

 3  glyco-bond=s--s sugar=-3-. groove=w-n- Major-->WC N- nts=4 GGGG A.DG3,A.DG8,A.DG22,A.DG17
4 glyco-bond=-ss- sugar=3--. groove=w-n- WC-->Major N+ nts=4 GGGG A.DG4,A.DG7,A.DG21,A.DG18
step#3 mm(<>,outward) area=17.43 rise=3.05 twist=13.8

Download PDB file
Interactive view in 3Dmol.js

List of 1 G4-stem

In DSSR, a G4-stem is defined as a G4-helix with backbone connectivity. Bulges are also allowed along each of the four strands.

Stem#1, 4 G-tetrads, 3 loops, INTRA-molecular, UDDU, anti-parallel:basket, 2+2, 4(-LwD+Ln)
 1  glyco-bond=s--s sugar=---- groove=w-n- Major-->WC N- nts=4 GGGG A.DG1,A.DG10,A.DG24,A.DG15
 2  glyco-bond=-ss- sugar=---- groove=w-n- WC-->Major N+ nts=4 GGGG A.DG2,A.DG9,A.DG23,A.DG16
 3  glyco-bond=s--s sugar=-3-. groove=w-n- Major-->WC N- nts=4 GGGG A.DG3,A.DG8,A.DG22,A.DG17
 4  glyco-bond=-ss- sugar=3--. groove=w-n- WC-->Major N+ nts=4 GGGG A.DG4,A.DG7,A.DG21,A.DG18
  step#1  mm(<>,outward)  area=9.79  rise=3.06 twist=24.9
  step#2  pp(><,inward)   area=13.88 rise=3.39 twist=30.2
  step#3  mm(<>,outward)  area=17.43 rise=3.05 twist=13.8
  strand#1  U DNA glyco-bond=s-s- sugar=---3 nts=4 GGGG A.DG1,A.DG2,A.DG3,A.DG4
  strand#2  D DNA glyco-bond=-s-s sugar=--3- nts=4 GGGG A.DG10,A.DG9,A.DG8,A.DG7
  strand#3  D DNA glyco-bond=-s-s sugar=---- nts=4 GGGG A.DG24,A.DG23,A.DG22,A.DG21
  strand#4  U DNA glyco-bond=s-s- sugar=--.. nts=4 GGGG A.DG15,A.DG16,A.DG17,A.DG18
  loop#1 type=lateral   strands=[#1,#2] nts=2 TT A.DT5,A.DT6
  loop#2 type=diagonal  strands=[#2,#4] nts=4 TTTT A.DT11,A.DT12,A.DT13,A.DT14
  loop#3 type=lateral   strands=[#4,#3] nts=2 AA A.DA19,A.DA20

Download PDB file
Interactive view in 3Dmol.js