pdb-id class method authors reference annotation
139d DNA NMR Wang Y, Patel DJ (1993) "Solution structure of a parallel-stranded G-quadruplex DNA." J.Mol.Biol., 234, 1171-1183. doi: 10.1006/jmbi.1993.1668. Solution structure of a parallel-stranded g-quadruplex DNA . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0
143d DNA NMR Wang Y, Patel DJ (1993) "Solution structure of the human telomeric repeat d[AG3(T2AG3)3] G-tetraplex." Structure, 1, 263-282. doi: 10.1016/0969-2126(93)90015-9. Solution structure of the human telomeric repeat d(ag3[t2ag3]3) of the g-quadruplex . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UDDU, anti-parallel:basket, 2+2, 3(-LwD+Ln)
148d DNA NMR Schultze P, Macaya RF, Feigon J (1994) "Three-dimensional solution structure of the thrombin-binding DNA aptamer d(GGTTGGTGTGGTTGG)." J.Mol.Biol., 235, 1532-1547. doi: 10.1006/jmbi.1994.1105. Three-dimensional solution structure of the thrombin binding DNA aptamer d(ggttggtgtggttgg) . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
156d DNA NMR Schultze P, Smith FW, Feigon J (1994) "Refined solution structure of the dimeric quadruplex formed from the Oxytricha telomeric oligonucleotide d(GGGGTTTTGGGG)." Structure, 2, 221-233. doi: 10.1016/S0969-2126(00)00023-X. Refined solution structure of the dimeric quadruplex formed from the oxytricha telomeric oligonucleotide d(ggggttttgggg) . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UDDU, anti-parallel:basket, 2+2
186d DNA NMR Wang Y, Patel DJ (1994) "Solution structure of the Tetrahymena telomeric repeat d(T2G4)4 G-tetraplex." Structure, 2, 1141-1156. doi: 10.1016/S0969-2126(94)00117-0. Solution structure of the tetrahymena telomeric repeat d(t2g4)4 g-tetraplex . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UDUU, hybrid3, 3+1, 3(-Lw-Ln-P)
1a6h DNA NMR Kettani A, Kumar RA, Patel DJ (1995) "Solution structure of a DNA quadruplex containing the fragile X syndrome triplet repeat." J.Mol.Biol., 254, 638-656. doi: 10.1006/jmbi.1995.0644. DNA quadruplex containing gcgc tetrad, NMR, 4 structures . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UDUD, anti-parallel:chair, 2+2
1a8n DNA NMR Kettani A, Bouaziz S, Gorin A, Zhao H, Jones RA, Patel DJ (1998) "Solution structure of a Na cation stabilized DNA quadruplex containing G.G.G.G and G.C.G.C tetrads formed by G-G-G-C repeats observed in adeno-associated viral DNA." J.Mol.Biol., 282, 619-636. doi: 10.1006/jmbi.1998.2030. Solution structure of a na+ cation stabilized DNA quadruplex containing g.g.g.g and g.c.g.c tetrads formed by g-g-g-c repeats observed in aav and human chromosome 19, NMR, 8 structures . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UDUD, anti-parallel:chair, 2+2
1a8w DNA NMR Bouaziz S, Kettani A, Patel DJ (1998) "A K cation-induced conformational switch within a loop spanning segment of a DNA quadruplex containing G-G-G-C repeats." J.Mol.Biol., 282, 637-652. doi: 10.1006/jmbi.1998.2031. A k+ cation-induced conformational switch within a loop spanning segment of a DNA quadruplex containing g-g-g-c repeats, NMR, 8 structures . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UDUD, anti-parallel:chair, 2+2
1aff DNA NMR Kettani A, Bouaziz S, Wang W, Jones RA, Patel DJ (1997) "Bombyx mori single repeat telomeric DNA sequence forms a G-quadruplex capped by base triads." Nat.Struct.Biol., 4, 382-389. doi: 10.1038/nsb0597-382. DNA quadruplex containing gggg tetrads and (t.a).a triads, NMR, 8 structures . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UUDD, anti-parallel:basket2, 2+2
1bub DNA NMR Beger RD, Marathias VM, Volkman BF, Bolton PH (1998) "Determination of internuclear angles of DNA using paramagnetic-assisted magnetic alignment." J.Magn.Reson., 135, 256-259. doi: 10.1006/jmre.1998.1527. Determination of internuclear angles of DNA using paramagnetic assisted magnetic alignment . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
1c32 DNA NMR Marathias VM, Bolton PH (2000) "Structures of the potassium-saturated, 2:1, and intermediate, 1:1, forms of a quadruplex DNA." Nucleic Acids Res., 28, 1969-1977. doi: 10.1093/nar/28.9.1969. Solution structure of a quadruplex forming DNA and its intermidiate . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UDUD, anti-parallel:chair, 2+2, 2(+Lx+Lx+Ln)
1c34 DNA NMR Marathias VM, Bolton PH (2000) "Structures of the potassium-saturated, 2:1, and intermediate, 1:1, forms of a quadruplex DNA." Nucleic Acids Res., 28, 1969-1977. doi: 10.1093/nar/28.9.1969. Solution structure of a quadruplex forming DNA and its intermidiate . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
1c35 DNA NMR Marathias VM, Bolton PH (2000) "Structures of the potassium-saturated, 2:1, and intermediate, 1:1, forms of a quadruplex DNA." Nucleic Acids Res., 28, 1969-1977. doi: 10.1093/nar/28.9.1969. Solution structure of a quadruplex forming DNA and its intermidiate . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UDUD, anti-parallel:chair, 2+2, 2(+Lx+Lx+Ln)
1c38 DNA NMR Marathias VM, Bolton PH (2000) "Structures of the potassium-saturated, 2:1, and intermediate, 1:1, forms of a quadruplex DNA." Nucleic Acids Res., 28, 1969-1977. doi: 10.1093/nar/28.9.1969. Solution structure of a quadruplex forming DNA and its intermediate . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
1d59 DNA X-ray (2.3 Å) Kang C, Zhang X, Ratliff R, Moyzis R, Rich A (1992) "Crystal structure of four-stranded Oxytricha telomeric DNA." Nature, 356, 126-131. doi: 10.1038/356126a0. Crystal structure of 4-stranded oxytricha telomeric DNA . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UDUD, anti-parallel:chair, 2+2
1d6d DNA NMR Kuryavyi V, Kettani A, Wang W, Jones R, Patel DJ (2000) "A diamond-shaped zipper-like DNA architecture containing triads sandwiched between mismatches and tetrads." J.Mol.Biol., 295, 455-469. doi: 10.1006/jmbi.1999.3345. Solution DNA structure containing (a-a)-t triads interdigitated between a-t base pairs and gggg tetrads; NMR, 8 struct. . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UUDD, anti-parallel:basket2, 2+2
1eeg DNA NMR Kettani A, Gorin A, Majumdar A, Hermann T, Skripkin E, Zhao H, Jones R, Patel DJ (2000) "A dimeric DNA interface stabilized by stacked A.(G.G.G.G).A hexads and coordinated monovalent cations." J.Mol.Biol., 297, 627-644. doi: 10.1006/jmbi.2000.3524. A(gggg)a hexad pairing aligment for the d(g-g-a-g-g-a-g) sequence . 4 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, UUUU, parallel, 4+0, coaxial interfaces: 5'/5'
1emq DNA NMR Patel PK, Hosur RV (1999) "NMR observation of T-tetrads in a parallel stranded DNA quadruplex formed by Saccharomyces cerevisiae telomere repeats." Nucleic Acids Res., 27, 2457-2464. doi: 10.1093/nar/27.12.2457. NMR observation of t-tetrads in a parallel stranded DNA quadruplex formed by saccharomyces cerevisiae telomere repeats . 4 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, UUUU, parallel, 4+0, coaxial interfaces: 3'/5'
1evm DNA NMR Patel PK, Koti AS, Hosur RV (1999) "NMR studies on truncated sequences of human telomeric DNA: observation of a novel A-tetrad." Nucleic Acids Res., 27, 3836-3843. doi: 10.1093/nar/27.19.3836. NMR observation of a-tetrad . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0
1evn DNA NMR Patel PK, Koti AS, Hosur RV (1999) "NMR studies on truncated sequences of human telomeric DNA: observation of a novel A-tetrad." Nucleic Acids Res., 27, 3836-3843. doi: 10.1093/nar/27.19.3836. NMR observation of a-tetrad . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0
1evo DNA NMR Patel PK, Bhavesh NS, Hosur RV (2000) "NMR observation of a novel C-tetrad in the structure of the SV40 repeat sequence GGGCGG." Biochem.Biophys.Res.Commun., 270, 967-971. doi: 10.1006/bbrc.2000.2479. NMR observation of a novel c-tetrad . 5 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, UUUU, parallel, 4+0, coaxial interfaces: 3'/5'
1f3s DNA NMR Kettani A, Basu G, Gorin A, Majumdar A, Skripkin E, Patel DJ (2000) "A two-stranded template-based approach to G.(C-A) triad formation: designing novel structural elements into an existing DNA framework." J.Mol.Biol., 301, 129-146. doi: 10.1006/jmbi.2000.3932. Solution structure of DNA sequence gggttcagg forms gggg tetrade and g(c-a) triad. . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UDUD, anti-parallel:chair, 2+2
1fqp DNA NMR Keniry MA, Strahan GD, Owen EA, Shafer RH (1995) "Solution structure of the Na+ form of the dimeric guanine quadruplex [d(G3T4G3)]2." Eur.J.Biochem., 233, 631-643. doi: 10.1111/j.1432-1033.1995.631_2.x. Intramolecular quadruplex DNA with three gggg repeats, NMR, ph 6.7, 0.1 m na+ and 4 mm (strand concentration), 5 structures . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UDDU, anti-parallel:basket, 2+2
1hao hydrolase-hydrolase inhibitor-DNA X-ray (2.8 Å) Padmanabhan K, Tulinsky A (1996) "An ambiguous structure of a DNA 15-mer thrombin complex." Acta Crystallogr.,Sect.D, 52, 272-282. doi: 10.1107/S0907444995013977. Complex of human alpha-thrombin with a 15mer oligonucleotide ggttggtgtggttgg (based on NMR model of DNA) . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
1hap hydrolase-hydrolase inhibitor-DNA X-ray (2.8 Å) Padmanabhan K, Tulinsky A (1996) "An ambiguous structure of a DNA 15-mer thrombin complex." Acta Crystallogr.,Sect.D, 52, 272-282. doi: 10.1107/S0907444995013977. Complex of human alpha-thrombin with a 15mer oligonucleotide ggttggtgtggttgg (based on x-ray model of DNA) . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UDUD, anti-parallel:chair, 2+2, 2(-Lw-Ln-Lw)
1hut hydrolase-hydrolase inhibitor-DNA X-ray (2.9 Å) Padmanabhan K, Padmanabhan KP, Ferrara JD, Sadler JE, Tulinsky A (1993) "The structure of alpha-thrombin inhibited by a 15-mer single-stranded DNA aptamer." J.Biol.Chem., 268, 17651-17654. The structure of alpha-thrombin inhibited by a 15-mer single-stranded DNA aptamer . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UDUD, anti-parallel:chair, 2+2, 2(-Lw-Ln-Lw)
1i34 DNA NMR Kuryavyi V, Majumdar A, Shallop A, Chernichenko N, Skripkin E, Jones R, Patel DJ (2001) "A double chain reversal loop and two diagonal loops define the architecture of a unimolecular DNA quadruplex containing a pair of stacked G(syn)-G(syn)-G(anti)-G(anti) tetrads flanked by a G-(T-T) Triad and a T-T-T triple." J.Mol.Biol., 310, 181-194. doi: 10.1006/jmbi.2001.4759. Solution DNA quadruplex with double chain reversal loop and two diagonal loops connecting gggg tetrads flanked by g-(t-t) triad and t-t-t triple . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UDDU, anti-parallel:basket, 2+2, 2(D+PD)
1j6s RNA X-ray (1.4 Å) Pan B, Xiong Y, Shi K, Deng J, Sundaralingam M (2003) "Crystal structure of an RNA purine-rich tetraplex containing adenine tetrads: implications for specific binding in RNA tetraplexes." Structure, 11, 815-823. doi: 10.1016/S0969-2126(03)00107-2. Crystal structure of an RNA tetraplex (ugaggu)4 with a-tetrads, g-tetrads, u-tetrads and g-u octads . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0
1j8g RNA X-ray (0.61 Å) Deng J, Xiong Y, Sundaralingam M (2001) "X-ray analysis of an RNA tetraplex (UGGGGU)(4) with divalent Sr(2+) ions at subatomic resolution (0.61 A)." Proc.Natl.Acad.Sci.USA, 98, 13665-13670. doi: 10.1073/pnas.241374798. X-ray analysis of a RNA tetraplex r(uggggu)4 at ultra-high resolution . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0
1jb7 DNA-binding protein-DNA X-ray (1.86 Å) Horvath MP, Schultz SC (2001) "DNA G-quartets in a 1.86 A resolution structure of an Oxytricha nova telomeric protein-DNA complex." J.Mol.Biol., 310, 367-377. doi: 10.1006/jmbi.2001.4766. DNA g-quartets in a 1.86 Å resolution structure of an oxytricha nova telomeric protein-DNA complex . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UDDU, anti-parallel:basket, 2+2
1jjp DNA NMR Zhang N, Gorin A, Majumdar A, Kettani A, Chernichenko N, Skripkin E, Patel DJ (2001) "V-shaped scaffold: a new architectural motif identified in an A x (G x G x G x G) pentad-containing dimeric DNA quadruplex involving stacked G(anti) x G(anti) x G(anti) x G(syn) tetrads." J.Mol.Biol., 311, 1063-1079. doi: 10.1006/jmbi.2001.4916. A(gggg) pentad-containing dimeric DNA quadruplex involving stacked g(anti)g(anti)g(anti)g(syn) tetrads . 4 G-tetrads, 1 G4 helix
1jpq DNA X-ray (1.6 Å) Haider S, Parkinson GN, Neidle S (2002) "Crystal structure of the potassium form of an Oxytricha nova G-quadruplex." J.Mol.Biol., 320, 189-200. doi: 10.1016/S0022-2836(02)00428-X. Crystal structure of the oxytricha telomeric DNA at 1.6a . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UDDU, anti-parallel:basket, 2+2
1jrn DNA X-ray (2.0 Å) Haider S, Parkinson GN, Neidle S (2002) "Crystal structure of the potassium form of an Oxytricha nova G-quadruplex." J.Mol.Biol., 320, 189-200. doi: 10.1016/S0022-2836(02)00428-X. Orthorhombic form of oxytricha telomeric DNA at 2.0a . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UDDU, anti-parallel:basket, 2+2
1jvc DNA NMR Zhang N, Gorin A, Majumdar A, Kettani A, Chernichenko N, Skripkin E, Patel DJ (2001) "Dimeric DNA quadruplex containing major groove-aligned A-T-A-T and G-C-G-C tetrads stabilized by inter-subunit Watson-Crick A-T and G-C pairs." J.Mol.Biol., 312, 1073-1088. doi: 10.1006/jmbi.2001.5002. Dimeric DNA quadruplex containing major groove-aligned a.t.a.t and g.c.g.c tetrads stabilized by inter-subunit watson-crick a:t and g:c pairs . 1 G-tetrad
1k4x DNA NMR Schultze P, Hud NV, Smith FW, Feigon J (1999) "The effect of sodium, potassium and ammonium ions on the conformation of the dimeric quadruplex formed by the Oxytricha nova telomere repeat oligonucleotide d(G(4)T(4)G(4))." Nucleic Acids Res., 27, 3018-3028. doi: 10.1093/nar/27.15.3018. Potassium form of oxy-1.5 quadruplex DNA . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UDDU, anti-parallel:basket, 2+2
1k8p DNA X-ray (2.4 Å) Parkinson GN, Lee MP, Neidle S (2002) "Crystal structure of parallel quadruplexes from human telomeric DNA." Nature, 417, 876-880. doi: 10.1038/nature755. Structure of the human g-quadruplex reveals a novel topology . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0
1kf1 DNA X-ray (2.1 Å) Parkinson GN, Lee MP, Neidle S (2002) "Crystal structure of parallel quadruplexes from human telomeric DNA." Nature, 417, 876-880. doi: 10.1038/nature755. Structure and packing of human telomeric DNA . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
1l1h DNA X-ray (1.75 Å) Haider SM, Parkinson GN, Neidle S (2003) "Structure of a G-quadruplex-Ligand Complex." J.Mol.Biol., 326, 117-125. doi: 10.1016/S0022-2836(02)01354-2. Crystal structure of the quadruplex DNA-drug complex . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UDDU, anti-parallel:basket, 2+2
1lvs DNA NMR Crnugelj M, Hud NV, Plavec J (2002) "The solution structure of d(G(4)T(4)G(3))(2): a bimolecular G-quadruplex with a novel fold." J.Mol.Biol., 320, 911-924. doi: 10.1016/S0022-2836(02)00569-7. The solution structure of d(g4t4g3)2 . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UDDU, anti-parallel:basket, 2+2
1mdg RNA X-ray (1.5 Å) Pan BC, Xiong Y, Shi K, Sundaralingam M (2003) "An Eight-Stranded Helical Fragment in RNA Crystal Structure: Implications for Tetraplex Interaction." Structure, 11, 825-831. doi: 10.1016/S0969-2126(03)00108-4. An alternating antiparallel octaplex in an RNA crystal structure . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0
1my9 RNA NMR Liu H, Matsugami A, Katahira M, Uesugi S (2002) "A Dimeric RNA Quadruplex Architecture Comprised of Two G:G(:A):G:G(:A) Hexads, G:G:G:G Tetrads and UUUU Loops." J.Mol.Biol., 322, 955-970. doi: 10.1016/S0022-2836(02)00876-8. Solution structure of a k+ cation stabilized dimeric RNA quadruplex containing two g:g(:a):g:g(:a) hexads, g:g:g:g tetrads and uuuu loops . 4 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, UUUU, parallel, 4+0, 2(-P-P-P), coaxial interfaces: 5'/5'
1myq DNA NMR Matsugami A, Ouhashi K, Kanagawa M, Liu H, Kanagawa S, Uesugi S, Katahira M (2001) "An intramolecular quadruplex of (GGA)(4) triplet repeat DNA with a G:G:G:G tetrad and a G(:A):G(:A):G(:A):G heptad, and its dimeric interaction." J.Mol.Biol., 313, 255-269. doi: 10.1006/jmbi.2001.5047. An intramolecular quadruplex of (gga)(4) triplet repeat DNA with a g:g:g:g tetrad and a g(:a):g(:a):g(:a):g heptad, and its dimeric interaction . 4 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, UUUU, parallel, 4+0, 2(-P-P-P), coaxial interfaces: 5'/5'
1n7a DNA, RNA X-ray (1.2 Å) Ravelli RBG, Leiros H-KS, Pan B, Caffrey M, McSweeney S (2003) "Specific Radiation-Damage Can Be Used To Solve Macromolecular Crystal Structures." Structure, 11, 217-224. doi: 10.1016/S0969-2126(03)00006-6. Rip-radiation-damage induced phasing . 6 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, UUUU, parallel, 4+0, coaxial interfaces: 5'/5'-SEPARATED
1n7b DNA, RNA X-ray (1.4 Å) Ravelli RBG, Leiros H-KS, Pan B, Caffrey M, McSweeney S (2003) "Specific Radiation-Damage Can Be Used To Solve Macromolecular Crystal Structures." Structure, 11, 217-224. doi: 10.1016/S0969-2126(03)00006-6. Rip-radiation-damage induced phasing . 6 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, UUUU, parallel, 4+0, coaxial interfaces: 5'/5'-SEPARATED
1np9 DNA NMR Gavathiotis E, Searle MS (2003) "Structure of the parallel-stranded DNA quadruplex d(TTAGGGT)4 containing the human telomeric repeat: evidence for A-tetrad formation from NMR and molecular dynamics simulations." ORG.BIOMOL.CHEM., 1, 1650-1656. doi: 10.1039/b300845m. Structure of the parallel-stranded DNA quadruplex d(ttaggga)4 containing the human telomeric repeat . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0
1nyd DNA NMR Webba da Silva M (2003) "Association of DNA quadruplexes through G:C:G:C tetrads. Solution structure of d(GCGGTGGAT)." Biochemistry, 42, 14356-14365. doi: 10.1021/bi0355185. Solution structure of DNA quadruplex gcggtggat . 4 G-tetrads, 2 G4 helices, 2 G4 stems, UUUU, parallel, 4+0
1nzm DNA NMR Gavathiotis E, Heald RA, Stevens MFG, Searle MS (2003) "Drug Recognition and Stabilisation of the Parallel-stranded DNA Quadruplex d(TTAGGGT)4 Containing the Human Telomeric Repeat." J.Mol.Biol., 334, 25-36. doi: 10.1016/j.jmb.2003.09.018. NMR structure of the parallel-stranded DNA quadruplex d(ttagggt)4 complexed with the telomerase inhibitor rhps4 . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0
1o0k DNA X-ray (1.17 Å) Clark GR, Pytel PD, Squire CJ, Neidle S (2003) "Structure of the First Parallel DNA Quadruplex-drug Complex." J.Am.Chem.Soc., 125, 4066-4067. doi: 10.1021/ja0297988. Structure of the first parallel DNA quadruplex-drug complex . 8 G-tetrads, 2 G4 helices, 2 G4 stems, UUUU, parallel, 4+0
1oz8 DNA NMR Matsugami A, Okuizumi T, Uesugi S, Katahira M (2003) "Intramolecular Higher Order Packing of Parallel Quadruplexes Comprising a G:G:G:G Tetrad and a G(:A):G(:A):G(:A):G Heptad of GGA Triplet Repeat DNA." J.BIOL.CHEM., 278, 28147-28153. doi: 10.1074/jbc.M303694200. Intramolecular higher-order packing of parallel quadruplexes comprising a g:g:g:g tetrad and a g(:a):g(:a):g(:a):g heptad of gga triplet repeat DNA . 4 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, UUUU, parallel, 4+0, 2(-P-P-P), coaxial interfaces: 5'/5'
1pa6 DNA binding protein-DNA X-ray (2.45 Å) Theobald DL, Schultz SC (2003) "Nucleotide shuffling and ssDNA recognition in Oxytricha nova telomere end-binding protein complexes." Embo J., 22, 4314-4324. doi: 10.1093/emboj/cdg415. Crystal structure of the oxytricha nova telomere end-binding protein complexed with noncognate ssDNA ggggttttgagg . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UDDU, anti-parallel:basket, 2+2
1ph1 DNA binding protein-DNA X-ray (2.51 Å) Theobald DL, Schultz SC (2003) "Nucleotide Shuffling and Ssdna Recognition in Oxytricha Nova Telomere End-Binding Protein Complexes." Embo J., 22, 4314-4324. doi: 10.1093/emboj/cdg415. Crystal structure of the oxytricha nova telomere end-binding protein complexed with noncognate ssDNA ggggttttggggt . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UDDU, anti-parallel:basket, 2+2
1ph2 DNA binding protein-DNA X-ray (3.1 Å) Theobald DL, Schultz SC (2003) "Nucleotide Shuffling and ssDNA Recognition in Oxytricha Nova Telomere End-Binding Protein Complexes." Embo J., 22, 4314-4324. doi: 10.1093/emboj/cdg415. Crystal structure of the oxytricha nova telomere end-binding protein complexed with noncognate ssDNA ggggttttg . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UDDU, anti-parallel:basket, 2+2
1ph3 DNA binding protein-DNA X-ray (2.3 Å) Theobald DL, Schultz SC (2003) "Nucleotide Shuffling and ssDNA Recognition in Oxytricha Nova Telomere End-Binding Protein Complexes." Embo J., 22, 4314-4324. doi: 10.1093/emboj/cdg415. Crystal structure of the oxytricha nova telomere end-binding protein complexed with noncognate ssDNA ggggttttggtg . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UDDU, anti-parallel:basket, 2+2
1ph4 DNA binding protein-DNA X-ray (2.3 Å) Theobald DL, Schultz SC (2003) "Nucleotide Shuffling and ssDNA Recognition in Oxytricha Nova Telomere End-Binding Protein Complexes." Embo J., 22, 4314-4324. doi: 10.1093/emboj/cdg415. Crystal structure of the oxytricha nova telomere end-binding protein complexed with noncognate ssDNA ggggttttggcg . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UDDU, anti-parallel:basket, 2+2
1ph5 DNA binding protein-DNA X-ray (2.3 Å) Theobald DL, Schultz SC (2003) "Nucleotide Shuffling and ssDNA Recognition in Oxytricha Nova Telomere End-Binding Protein Complexes." Embo J., 22, 4314-4324. doi: 10.1093/emboj/cdg415. Crystal structure of the oxytricha nova telomere end-binding protein complexed with noncognate ssDNA ggggttttg(3dr)gg . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UDDU, anti-parallel:basket, 2+2
1ph6 DNA binding protein-DNA X-ray (2.1 Å) Theobald DL, Schultz SC (2003) "Nucleotide Shuffling and ssDNA Recognition in Oxytricha Nova Telomere End-Binding Protein Complexes." Embo J., 22, 4314-4324. doi: 10.1093/emboj/cdg415. Crystal structure of the oxytricha nova telomere end-binding protein complexed with noncognate ssDNA ggggttttgtgg . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UDDU, anti-parallel:basket, 2+2
1ph7 DNA binding protein-DNA X-ray (2.9 Å) Theobald DL, Schultz SC (2003) "Nucleotide Shuffling and ssDNA Recognition in Oxytricha Nova Telomere End-Binding Protein Complexes." Embo J., 22, 4314-4324. doi: 10.1093/emboj/cdg415. Crystal structure of the oxytricha nova telomere end-binding protein complexed with noncognate ssDNA ggggttttgigg . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UDDU, anti-parallel:basket, 2+2
1ph8 DNA binding protein-DNA X-ray (2.36 Å) Theobald DL, Schultz SC (2003) "Nucleotide Shuffling and Ssdna Recognition in Oxytricha Nova Telomere End-Binding Protein Complexes." Embo J., 22, 4314-4324. doi: 10.1093/emboj/cdg415. Crystal structure of the oxytricha nova telomere end-binding protein complexed with noncognate ssDNA ggggttttgcgg . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UDDU, anti-parallel:basket, 2+2
1ph9 DNA binding protein-DNA X-ray (2.5 Å) Theobald DL, Schultz SC (2003) "Nucleotide Shuffling and ssDNA Recognition in Oxytricha Nova Telomere End-Binding Protein Complexes." Embo J., 22, 4314-4324. doi: 10.1093/emboj/cdg415. Crystal structure of the oxytricha nova telomere end-binding protein complexed with noncognate ssDNA ggggttttgagg . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UDDU, anti-parallel:basket, 2+2
1phj DNA binding protein-DNA X-ray (2.5 Å) Theobald DL, Schultz SC (2003) "Nucleotide Shuffling and ssDNA Recognition in Oxytricha Nova Telomere End-Binding Protein Complexes." Embo J., 22, 4314-4324. doi: 10.1093/emboj/cdg415. Crystal structure of the oxytricha nova telomere end-binding protein complexed with noncognate ssDNA gg(3dr)gttttgggg . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UDDU, anti-parallel:basket, 2+2
1qdf DNA NMR Marathias VM, Wang KY, Kumar S, Pham TQ, Swaminathan S, Bolton PH (1996) "Determination of the number and location of the manganese binding sites of DNA quadruplexes in solution by EPR and NMR in the presence and absence of thrombin." J.Mol.Biol., 260, 378-394. doi: 10.1006/jmbi.1996.0408. The NMR study of DNA quadruplex structure, aptamer (15mer) DNA . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
1qdh DNA NMR Marathias VM, Wang KY, Kumar S, Pham TQ, Swaminathan S, Bolton PH (1996) "Determination of the number and location of the manganese binding sites of DNA quadruplexes in solution by EPR and NMR in the presence and absence of thrombin." J.Mol.Biol., 260, 378-394. doi: 10.1006/jmbi.1996.0408. The NMR study of DNA quadruplex structure, aptamer (15mer) DNA . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
1qdi DNA NMR Marathias VM, Wang KY, Kumar S, Pham TQ, Swaminathan S, Bolton PH (1996) "Determination of the number and location of the manganese binding sites of DNA quadruplexes in solution by EPR and NMR in the presence and absence of thrombin." J.Mol.Biol., 260, 378-394. doi: 10.1006/jmbi.1996.0408. The NMR study of DNA quadruplex structure, (12mer) DNA . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UDDU, anti-parallel:basket, 2+2
1qdk DNA NMR Marathias VM, Wang KY, Kumar S, Pham TQ, Swaminathan S, Bolton PH (1996) "Determination of the number and location of the manganese binding sites of DNA quadruplexes in solution by EPR and NMR in the presence and absence of thrombin." J.Mol.Biol., 260, 378-394. doi: 10.1006/jmbi.1996.0408. The NMR study of DNA quadruplex structure, (12mer) DNA . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UDDU, anti-parallel:basket, 2+2
1rau RNA NMR Cheong C, Moore PB (1992) "Solution structure of an unusually stable RNA tetraplex containing G- and U-quartet structures." Biochemistry, 31, 8406-8414. doi: 10.1021/bi00151a003. Solution structure of an unusually stable RNA tetraplex containing g-and u-quartet structures . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0
1rde DNA NMR Mao X, Marky LA, Gmeiner WH (2004) "NMR structure of the thrombin-binding DNA aptamer stabilized by Sr2+." J.Biomol.Struct.Dyn., 22, 25-33. NMR structure of the thrombin-binding DNA aptamer stabilized by sr2+ . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
1s45 DNA X-ray (2.2 Å) Caceres C, Wright G, Gouyette C, Parkinson G, Subirana JA (2004) "A Thymine tetrad in d(TGGGGT) quadruplexes stabilized with Tl+1/Na+1 ions." Nucleic Acids Res., 32, 1097-1102. doi: 10.1093/nar/gkh269. Crystal structure analysis of the DNA quadruplex d(tggggt) s1 . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0
1s47 DNA X-ray (2.5 Å) Caceres C, Wright G, Gouyette C, Parkinson G, Subirana JA (2004) "A Thymine tetrad in d(TGGGGT) quadruplexes stabilized with Tl+1/Na+1 ions." Nucleic Acids Res., 32, 1097-1102. doi: 10.1093/nar/gkh269. Crystal structure analysis of the DNA quadruplex d(tggggt)s2 . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0
1s9l RNA NMR Randazzo A, Esposito V, Ohlenschlager O, Ramachandran R, Mayola L (2004) "NMR solution structure of a parallel LNA quadruplex." Nucleic Acids Res., 32, 3083-3092. doi: 10.1093/nar/gkh629. NMR solution structure of a parallel lna quadruplex . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0
1u64 DNA NMR Sket P, Crnugelj M, Plavec J (2004) "d(G3T4G4) forms unusual dimeric G-quadruplex structure with the same general fold in the presence of K+, Na+ or NH4+ ions." Bioorg.Med.Chem., 12, 5735-5744. doi: 10.1016/j.bmc.2004.08.009. The solution structure of d(g3t4g4)2 . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UDDD, hybrid4, 1+3
1v3p DNA X-ray (2.3 Å) Kondo J, Adachi W, Umeda S, Sunami T, Takenaka A (2004) "Crystal structures of a DNA octaplex with I-motif of G-quartets and its splitting into two quadruplexes suggest a folding mechanism of eight tandem repeats." Nucleic Acids Res., 32, 2541-2549. doi: 10.1093/nar/gkh575. Crystal structure of d(gcgagagc): the DNA octaplex structure with i-motif of g-quartet . 2 G-tetrads, 1 G4 helix
1xav DNA NMR Ambrus A, Chen D, Dai J, Jones RA, Yang D (2005) "Solution structure of the biologically relevant G-Quadruplex element in the human c-MYC promoter. Implications for G-quadruplex stabilization." Biochemistry, 44, 2048-2058. doi: 10.1021/bi048242p. Major g-quadruplex structure formed in human c-myc promoter, a monomeric parallel-stranded quadruplex . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
1xce DNA NMR Webba da Silva M (2005) "Experimental Demonstration of T:(G:G:G):T Hexad and T:A:A:T Tetrad Alignments within a DNA Quadruplex Stem." Biochemistry, 44, 3754-3764. doi: 10.1021/bi0478190. Helica structure of DNA by design: the t(gggg)t hexad alignment . 4 G-tetrads, 2 G4 helices, 2 G4 stems, UUUU, parallel, 4+0
1y8d DNA NMR Phan AT, Kuryavyi VV, Ma J-B, Faure A, Andreola M-L, Patel DJ (2005) "An interlocked dimeric parallel-stranded DNA quadruplex: A potent inhibitor of HIV-1 integrase." Proc.Natl.Acad.Sci.USA, 102, 634-639. doi: 10.1073/pnas.0406278102. Dimeric parallel-stranded tetraplex with 3+1 5' g-tetrad interface, single-residue chain reversal loops and gag triad in the context of a(gggg) pentad . 6 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, UUUU, parallel, 4+0, 2(-P-P-P), coaxial interfaces: 5'/5'-SEPARATED
201d DNA NMR Wang Y, Patel DJ (1995) "Solution structure of the Oxytricha telomeric repeat d[G4(T4G4)3] G-tetraplex." J.Mol.Biol., 251, 76-94. doi: 10.1006/jmbi.1995.0417. Solution structure of the oxytricha telomeric repeat d[g4(t4g4)3] g-tetraplex . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UDDU, anti-parallel:basket, 2+2, 4(-LwD+Ln)
21cc RNA NMR Iwakiri R, Wang SY, Xu Y "A solution NMR model of L-RNA r(UAGGGUUAGGGU) bounding Protoporphyrin IX ligand." A solution NMR model of l-RNA r(uaggguuagggu) bounding protoporphyrin ix ligand . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, negative twist
230d DNA NMR Smith FW, Schultze P, Feigon J (1995) "Solution structures of unimolecular quadruplexes formed by oligonucleotides containing Oxytricha telomere repeats." Structure, 3, 997-1008. doi: 10.1016/S0969-2126(01)00236-2. Solution structures of unimolecular quadruplexes formed by oligonucleotides containing oxytricha telomere repeats . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UDDU, anti-parallel:basket, 2+2, 4(-LwD+Ln)
244d DNA X-ray (1.2 Å) Laughlan G, Murchie AI, Norman DG, Moore MH, Moody PC, Lilley DM, Luisi B (1994) "The high-resolution crystal structure of a parallel-stranded guanine tetraplex." Science, 265, 520-524. The high-resolution crystal structure of a parallel-stranded guanine tetraplex . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0
26jr DNA NMR Li Y, Cao C "Structural Insights into the Binding of CX-5461 and MTR-106 to G-Quadruplex DNA." NMR solution structures of mtr-106-myt1lcomplex . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UDUU, hybrid3, 3+1, 3(-Lw-Ln-P)
26jt DNA NMR Li Y, Cao C "Structural Insights into the Binding of CX-5461 and MTR-106 to G-Quadruplex DNA." NMR solution structures of cx-5461-myt1l complex . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UDUU, hybrid3, 3+1, 3(-Lw-Ln-P)
2a5p DNA NMR Phan AT, Kuryavyi V, Gaw HY, Patel DJ (2005) "Small-molecule interaction with a five-guanine-tract G-quadruplex structure from the human MYC promoter." Nat.Chem.Biol., 1, 167-173. doi: 10.1038/nchembio723. Monomeric parallel-stranded DNA tetraplex with snap-back 3+1 3' g-tetrad, single-residue chain reversal loops, gag triad in the context of gaag diagonal loop, NMR, 8 struct. . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 2(-P-P-P)
2a5r DNA NMR Phan AT, Kuryavyi V, Gaw HY, Patel DJ (2005) "Small-molecule interaction with a five-guanine-tract G-quadruplex structure from the human MYC promoter." Nat.Chem.Biol., 1, 167-173. doi: 10.1038/nchembio723. Complex of tetra-(4-n-methylpyridyl) porphin with monomeric parallel-stranded DNA tetraplex, snap-back 3+1 3' g-tetrad, single-residue chain reversal loops, gag triad in the context of gaag diagonal loop, c-myc promoter, NMR, 6 struct. . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 2(-P-P-P)
2akg DNA NMR Gill ML, Strobel SA, Loria JP (2005) "(205)Tl NMR methods for the characterization of monovalent cation binding to nucleic acids." J.Am.Chem.Soc., 127, 16723-16732. doi: 10.1021/ja055358f. Thallium form of the g-quadruplex from oxytricha nova, d(g4t4g4)2 . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UDDU, anti-parallel:basket, 2+2
2aqy DNA NMR Zhang N, Phan AT, Patel DJ (2005) "(3 + 1) Assembly of three human telomeric repeats into an asymmetric dimeric G-quadruplex." J.Am.Chem.Soc., 127, 17277-17285. doi: 10.1021/ja0543090. (3+1) assembly of three human telomeric DNA repeats into an asymmetrical dimeric g-quadruplex . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUD, hybrid2, 3+1
2avh DNA X-ray (1.5 Å) Hazel P, Parkinson GN, Neidle S (2006) "Topology variation and loop structural homology in crystal and simulated structures of a bimolecular DNA quadruplex." J.Am.Chem.Soc., 128, 5480-5487. doi: 10.1021/ja058577+. G4t3g4 dimeric quadruplex structure . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UDUD, anti-parallel:chair, 2+2
2avj DNA X-ray (2.39 Å) Hazel P, Parkinson GN, Neidle S (2006) "Topology variation and loop structural homology in crystal and simulated structures of a bimolecular DNA quadruplex." J.Am.Chem.Soc., 128, 5480-5487. doi: 10.1021/ja058577+. G4(br)uttg4 dimeric quadruplex . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UDUD, anti-parallel:chair, 2+2
2awe RNA X-ray (2.1 Å) Pan B, Shi K, Sundaralingam M (2006) "Base-tetrad swapping results in dimerization of RNA quadruplexes: implications for formation of the i-motif RNA octaplex." Proc.Natl.Acad.Sci.Usa, 103, 3130-3134. doi: 10.1073/pnas.0507730103. Base-tetrad swapping results in dimerization of RNA quadruplexes: implications for formation of i-motif RNA octaplex . 6 G-tetrads, 2 G4 helices, 2 G4 stems, UUUU, parallel, 4+0
2chj nucleic acid NMR Nielsen JT, Arar K, Petersen M (2006) "NMR Solution Structures of Lna (Locked Nucleic Acid) Modified Quadruplexes." Nucleic Acids Res., 34, 2006. doi: 10.1093/NAR/GKL144. NMR structure of tglglt quadruplex . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0
2chk nucleic acid NMR Nielsen JT, Arar K, Petersen M (2006) "NMR Solution Structures of Lna (Locked Nucleic Acid) Modified Quadruplexes." Nucleic Acids Res., 34, 2006. doi: 10.1093/NAR/GKL144. NMR structure of tllllt quadruplex . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0
2e4i DNA NMR Matsugami A, Xu Y, Noguchi Y, Sugiyama H, Katahira M (2007) "Structure of a human telomeric DNA sequence stabilized by 8-bromoguanosine substitutions, as determined by NMR in a K+ solution." Febs J., 274, 3545-3556. doi: 10.1111/j.1742-4658.2007.05881.x. Human telomeric DNA mixed-parallel-antiparallel quadruplex under physiological ionic conditions stabilized by proper incorporation of 8-bromoguanosines . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUDU, hybrid1, 3+1, 3(-P-Lw-Ln)
2f8u DNA NMR Dai J, Chen D, Jones RA, Hurley LH, Yang D (2006) "NMR solution structure of the major G-quadruplex structure formed in the human BCL2 promoter region." Nucleic Acids Res., 34, 5133-5144. doi: 10.1093/nar/gkl610. G-quadruplex structure formed in human bcl-2 promoter, hybrid form . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UDUU, hybrid3, 3+1, 3(-Lw-Ln-P)
2gku DNA NMR Luu KN, Phan AT, Kuryavyi VV, Lacroix L, Patel DJ (2006) "Structure of the human telomere in k(+) solution: an intramolecular (3 + 1) g-quadruplex scaffold." J.Am.Chem.Soc., 128, 9963-9970. doi: 10.1021/ja062791w. Monomeric human telomere DNA tetraplex with 3+1 strand fold topology, two edgewise loops and double-chain reversal loop, NMR, 12 structures . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUDU, hybrid1, 3+1, 3(-P-Lw-Ln)
2grb RNA X-ray (1.4 Å) Pan B, Shi K, Sundaralingam M (2006) "Crystal structure of an RNA quadruplex containing inosine tetrad: implications for the roles of NH2 group in purine tetrads." J.Mol.Biol., 363, 451-459. doi: 10.1016/j.jmb.2006.08.022. Crystal structure of an RNA quadruplex containing inosine-tetrad . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0
2gw0 DNA X-ray (1.55 Å) Lee MP, Parkinson GN, Hazel P, Neidle S (2007) "Observation of the coexistence of sodium and calcium ions in a DNA G-quadruplex ion channel." J.Am.Chem.Soc., 129, 10106-10107. doi: 10.1021/ja0740869. A d(tggggt)- sodium and calcium complex. . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0
2gwe DNA X-ray (2.2 Å) Lee MPH, Haider S, Parkinson GN, Neidle S "Crystal structure of D(G4T4G4) with four and six quadruplexes in the asymmetric unit." Crystal structure of d(g4t4g4) with six quadruplexes in the asymmetric unit. . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UDDU, anti-parallel:basket, 2+2
2gwq DNA X-ray (2.0 Å) Lee MPH, Haider S, Parkinson GN, Neidle S "Crystal structure of D(G4T4G4) with four and six quadruplexes in the asymmetric unit." Crystal structure of d(g4t4g4) with four quadruplexes in the asymmetric unit. . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UDDU, anti-parallel:basket, 2+2
2hbn DNA X-ray (1.55 Å) Gill ML, Strobel SA, Loria JP (2006) "Crystallization and characterization of the thallium form of the Oxytricha nova G-quadruplex." Nucleic Acids Res., 34, 4506-4514. doi: 10.1093/nar/gkl616. Crystallization of the tl+-form of the oxytricha nova g-quadruplex . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UDDU, anti-parallel:basket, 2+2
2hri DNA X-ray (2.09 Å) Parkinson GN, Ghosh R, Neidle S (2007) "Structural basis for binding of porphyrin to human telomeres." Biochemistry, 46, 2390-2397. doi: 10.1021/bi062244n. A parallel stranded human telomeric quadruplex in complex with the porphyrin tmpyp4 . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0
2hy9 DNA NMR Dai J, Punchihewa C, Ambrus A, Chen D, Jones RA, Yang D (2007) "Structure of the intramolecular human telomeric G-quadruplex in potassium solution: a novel adenine triple formation." Nucleic Acids Res., 35, 2440-2450. doi: 10.1093/nar/gkm009. Human telomere DNA quadruplex structure in k+ solution hybrid-1 form . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUDU, hybrid1, 3+1, 3(-P-Lw-Ln)
2idn DNA NMR Martino L, Virno A, Randazzo A, Virgilio A, Esposito V, Giancola C, Bucci M, Cirino G, Mayol L (2006) "A new modified thrombin binding aptamer containing a 5'-5' inversion of polarity site." Nucleic Acids Res., 34, 6653-6662. doi: 10.1093/nar/gkl915. NMR structure of a new modified thrombin binding aptamer containing a 5'-5' inversion of polarity site . 2 G-tetrads, 1 G4 helix, 1 G4 stem, DDUD, ---???---, 1+3, 2(+Lm+Lw+Ln)
2jpz DNA NMR Dai J, Carver M, Punchihewa C, Jones RA, Yang D (2007) "Structure of the Hybrid-2 type intramolecular human telomeric G-quadruplex in K+ solution: insights into structure polymorphism of the human telomeric sequence." Nucleic Acids Res., 35, 4927-4940. doi: 10.1093/nar/gkm522. Human telomere DNA quadruplex structure in k+ solution hybrid-2 form . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UDUU, hybrid3, 3+1, 3(-Lw-Ln-P)
2jsk DNA NMR Phan AT, Kuryavyi V, Luu KN, Patel DJ (2007) "Structure of two intramolecular G-quadruplexes formed by natural human telomere sequences in K+ solution." Nucleic Acids Res., 35, 6517-6525. doi: 10.1093/nar/gkm706. Monomeric human telomere DNA tetraplex with 3+1 strand fold topology, two edgewise loops and double-chain reversal loop, 16 g form 1, NMR, 10 structures . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUDU, hybrid1, 3+1, 3(-P-Lw-Ln)
2jsl DNA NMR Phan AT, Kuryavyi V, Luu KN, Patel DJ (2007) "Structure of two intramolecular G-quadruplexes formed by natural human telomere sequences in K+ solution." Nucleic Acids Res., 35, 6517-6525. doi: 10.1093/nar/gkm706. Monomeric human telomere DNA tetraplex with 3+1 strand fold topology, two edgewise loops and double-chain reversal loop, form 2 natural, NMR, 10 structures . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UDUU, hybrid3, 3+1, 3(-Lw-Ln-P)
2jsm DNA NMR Phan AT, Kuryavyi V, Luu KN, Patel DJ (2007) "Structure of two intramolecular G-quadruplexes formed by natural human telomere sequences in K+ solution." Nucleic Acids Res., 35, 6517-6525. doi: 10.1093/nar/gkm706. Monomeric human telomere DNA tetraplex with 3+1 strand fold topology, two edgewise loops and double-chain reversal loop, NMR, 10 structures, form 1 natural . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUDU, hybrid1, 3+1, 3(-P-Lw-Ln)
2jsq DNA NMR Phan AT, Kuryavyi V, Luu KN, Patel DJ (2007) "Structure of two intramolecular G-quadruplexes formed by natural human telomere sequences in K+ solution." Nucleic Acids Res., 35, 6517-6525. doi: 10.1093/nar/gkm706. Monomeric human telomere DNA tetraplex with 3+1 strand fold topology, two edgewise loops and double-chain reversal loop, form 2 15brg, NMR, 10 structures . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UDUU, hybrid3, 3+1, 3(-Lw-Ln-P)
2jt7 DNA NMR Martino L, Virno A, Pagano B, Virgilio A, Di Micco S, Galeone A, Giancola C, Bifulco G, Mayol L, Randazzo A (2007) "Structural and thermodynamic studies of the interaction of distamycin A with the parallel quadruplex structure [d(TGGGGT)]4." J.Am.Chem.Soc., 129, 16048-16056. doi: 10.1021/ja075710k. NMR solution structure of the 4:1 distamycin a-[d(tggggt)]4 complex . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0
2jwq DNA NMR Hounsou C, Guittat L, Monchaud D, Jourdan M, Saettel N, Mergny JL, Teulade-Fichou M (2007) "G-Quadruplex Recognition by Quinacridines: a SAR, NMR, and Biological Study." ChemMedChem, 2, 655-666. doi: 10.1002/cmdc.200600286. G-quadruplex recognition by quinacridines: a sar, NMR and biological study . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0
2kaz DNA NMR Balkwill GD, Garner TP, Williams HE, Searle MS (2009) "Folding topology of a bimolecular DNA quadruplex containing a stable mini-hairpin motif within the diagonal loop." J.Mol.Biol., 385, 1600-1615. doi: 10.1016/j.jmb.2008.11.050. Folding topology of a bimolecular DNA quadruplex containing a stable mini-hairpin motif within the connecting loop . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUDD, anti-parallel:basket2, 2+2
2kbp RNA NMR Martadinata H, Phan AT (2009) "Structure of propeller-type parallel-stranded RNA G-quadruplexes, formed by human telomeric RNA sequences in K+ solution." J.Am.Chem.Soc., 131, 2570-2578. doi: 10.1021/ja806592z. Solution structure of a g-quadruplex of human telomeric RNA . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0
2kf7 DNA NMR Lim KW, Amrane S, Bouaziz S, Xu W, Mu Y, Patel DJ, Luu KN, Phan AT (2009) "Structure of the human telomere in K+ solution: a stable basket-type G-quadruplex with only two G-tetrad layers." J.Am.Chem.Soc., 131, 4301-4309. doi: 10.1021/ja807503g. Structure of a two-g-tetrad basket-type intramolecular g-quadruplex formed by human telomeric repeats in k+ solution (with g7-to-brg substitution) . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UDDU, anti-parallel:basket, 2+2, 2(-LwD+Ln)
2kf8 DNA NMR Lim KW, Amrane S, Bouaziz S, Xu W, Mu Y, Patel DJ, Luu KN, Phan AT (2009) "Structure of the human telomere in K+ solution: a stable basket-type G-quadruplex with only two G-tetrad layers." J.Am.Chem.Soc., 131, 4301-4309. doi: 10.1021/ja807503g. Structure of a two-g-tetrad basket-type intramolecular g-quadruplex formed by human telomeric repeats in k+ solution . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UDDU, anti-parallel:basket, 2+2, 2(-LwD+Ln)
2kka DNA NMR Zhang Z, Dai J, Veliath E, Jones RA, Yang D (2010) "Structure of a two-G-tetrad intramolecular G-quadruplex formed by a variant human telomeric sequence in K+ solution: insights into the interconversion of human telomeric G-quadruplex structures." Nucleic Acids Res., 38, 1009-1021. doi: 10.1093/nar/gkp1029. Human telomere DNA two-tetrad quadruplex structure in k+ solution . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UDDU, anti-parallel:basket, 2+2, 2(-LwD+Ln)
2km3 DNA NMR Lim KW, Alberti P, Guedin A, Lacroix L, Riou JF, Royle NJ, Mergny JL, Phan AT (2009) "Sequence variant (CTAGGG)n in the human telomere favors a G-quadruplex structure containing a G.C.G.C tetrad." Nucleic Acids Res., 37, 6239-6248. doi: 10.1093/nar/gkp630. Structure of an intramolecular g-quadruplex containing a g.c.g.c tetrad formed by human telomeric variant ctaggg repeats . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
2kow DNA NMR Hu L, Lim KW, Bouaziz S, Phan AT (2009) "Giardia Telomeric Sequence d(TAGGG)(4) Forms Two Intramolecular G-Quadruplexes in K(+) Solution: Effect of Loop Length and Sequence on the Folding Topology." J.Am.Chem.Soc., 131, 16824-16831. doi: 10.1021/ja905611c. Structure of a two-g-tetrad basket-type intramolecular g-quadruplex formed by giardia telomeric repeat d(taggg)4 in k+ solution (with g18-to-ino substitution) . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UUDD, anti-parallel:basket2, 2+2, 2(+LnD-Lw)
2kpr DNA NMR Kuryavyi V, Patel DJ (2010) "Solution Structure of a Unique G-Quadruplex Scaffold Adopted by a Guanosine-Rich Human Intronic Sequence." Structure, 18, 73-82. doi: 10.1016/j.str.2009.10.015. Monomeric intronic human chl1 gene quadruplex DNA NMR, 17 structures . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UDDD, hybrid4, 1+3, 2(-LwX+P)
2kqg DNA NMR Hsu S-TD, Varnai P, Bugaut A, Reszka AP, Neidle S, Balasubramanian S (2009) "A G-rich sequence within the c-kit oncogene promoter forms a parallel G-quadruplex having asymmetric G-tetrad dynamics." J.Am.Chem.Soc., 131, 13399-13409. doi: 10.1021/ja904007p. A g-rich sequence within the c-kit oncogene promoter forms a parallel g-quadruplex having asymmetric g-tetrad dynamics . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
2kqh DNA NMR Hsu S-TD, Varnai P, Bugaut A, Reszka AP, Neidle S, Balasubramanian S (2009) "A G-rich sequence within the c-kit oncogene promoter forms a parallel G-quadruplex having asymmetric G-tetrad dynamics." J.Am.Chem.Soc., 131, 13399-13409. doi: 10.1021/ja904007p. A g-rich sequence within the c-kit oncogene promoter forms a parallel g-quadruplex having asymmetric g-tetrad dynamics . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
2kvy DNA NMR Cosconati S, Marinelli L, Trotta R, Virno A, De Tito S, Romagnoli R, Pagano B, Limongelli V, Giancola C, Baraldi PG, Mayol L, Novellino E, Randazzo A (2010) "Structural and conformational requisites in DNA quadruplex groove binding: another piece to the puzzle." J.Am.Chem.Soc., 132, 6425-6433. doi: 10.1021/ja1003872. NMR solution structure of the 4:1 complex between an uncharged distamycin a analogue and [d(tggggt)]4 . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0
2kyo DNA NMR Kuryavyi V, Phan AT, Patel DJ (2010) "Solution structures of all parallel-stranded monomeric and dimeric G-quadruplex scaffolds of the human c-kit2 promoter." Nucleic Acids Res., 38, 6757-6773. doi: 10.1093/nar/gkq558. Dimeric human ckit-2 proto-oncogene promoter quadruplex DNA NMR, 10 structures . 6 G-tetrads, 2 G4 helices, 2 G4 stems, UUUU, parallel, 4+0
2kyp DNA NMR Kuryavyi V, Phan AT, Patel DJ (2010) "Solution structures of all parallel-stranded monomeric and dimeric G-quadruplex scaffolds of the human c-kit2 promoter." Nucleic Acids Res., 38, 6757-6773. doi: 10.1093/nar/gkq558. Monomeric human ckit-2 proto-oncogene promoter quadruplex DNA NMR, 12 structures . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
2kzd DNA NMR Lim KW, Lacroix L, Yue DJE, Lim JKC, Lim JMW, Phan AT (2010) "Coexistence of two distinct G-quadruplex conformations in the hTERT promoter." J.Am.Chem.Soc., 132, 12331-12342. doi: 10.1021/ja101252n. Structure of a (3+1) g-quadruplex formed by htert promoter sequence . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UDUU, hybrid3, 3+1, 3(-Lw-Ln-P)
2kze DNA NMR Lim KW, Lacroix L, Yue DJE, Lim JKC, Lim JMW, Phan AT (2010) "Coexistence of two distinct G-quadruplex conformations in the hTERT promoter." J.Am.Chem.Soc., 132, 12331-12342. doi: 10.1021/ja101252n. Structure of an all-parallel-stranded g-quadruplex formed by htert promoter sequence . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
2l7v DNA-inhibitor NMR Dai J, Carver M, Hurley LH, Yang D (2011) "Solution Structure of a 2:1 Quindoline-c-MYC G-Quadruplex: Insights into G-Quadruplex-Interactive Small Molecule Drug Design." J.Am.Chem.Soc., 133, 17673-17680. doi: 10.1021/ja205646q. Quindoline-g-quadruplex complex . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
2l88 DNA NMR Tong X, Lan W, Zhang X, Wu H, Liu M, Cao C (2011) "Solution structure of all parallel G-quadruplex formed by the oncogene RET promoter sequence." Nucleic Acids Res., 39, 6753-6763. doi: 10.1093/nar/gkr233. Solution structure of all parallel g-quadruplex formed by the oncogene ret promoter sequence . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
2la5 RNA binding protein-RNA NMR Phan AT, Kuryavyi V, Darnell JC, Serganov A, Majumdar A, Ilin S, Raslin T, Polonskaia A, Chen C, Clain D, Darnell RB, Patel DJ (2011) "Structure-function studies of FMRP RGG peptide recognition of an RNA duplex-quadruplex junction." Nat.Struct.Mol.Biol., 18, 796-804. doi: 10.1038/nsmb.2064. RNA duplex-quadruplex junction complex with fmrp rgg peptide . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 2(-P-P-P)
2lby DNA NMR Mathad RI, Hatzakis E, Dai J, Yang D (2011) "c-MYC promoter G-quadruplex formed at the 5'-end of NHE III1 element: insights into biological relevance and parallel-stranded G-quadruplex stability." Nucleic Acids Res., 39, 9023-9033. doi: 10.1093/nar/gkr612. G-quadruplex structure formed at the 5'-end of nheiii_1 element in human c-myc promoter . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
2ld8 DNA NMR Heddi B, Phan AT (2011) "Structure of Human Telomeric DNA in Crowded Solution." J.Am.Chem.Soc. doi: 10.1021/ja200786q. Structure of human telomeric DNA in crowded solution . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
2le6 DNA NMR Do NQ, Lim KW, Teo MH, Heddi B, Phan AT (2011) "Stacking of G-quadruplexes: NMR structure of a G-rich oligonucleotide with potential anti-HIV and anticancer activity." Nucleic Acids Res. doi: 10.1093/nar/gkr539. Structure of a dimeric all-parallel-stranded g-quadruplex stacked via the 5'-to-5' interface . 6 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, UUUU, parallel, 4+0, 3(-P-P-P), coaxial interfaces: 5'/5'
2led DNA NMR Trajkovski M, Webba da Silva M, Plavec J (2012) "Unique Structural Features of Interconverting Monomeric and Dimeric G-Quadruplexes Adopted by a Sequence from the Intron of the N-myc Gene." J.Am.Chem.Soc., 134, 4132-4141. doi: 10.1021/ja208483v. Unique structural features of interconverting monomeric and dimeric g-quadruplexes adopted by a sequence from intron of n-myc gene . 6 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, UUUU, parallel, 4+0, coaxial interfaces: 3'/5'
2lee DNA NMR Trajkovski M, Webba da Silva M, Plavec J (2012) "Unique Structural Features of Interconverting Monomeric and Dimeric G-Quadruplexes Adopted by a Sequence from the Intron of the N-myc Gene." J.Am.Chem.Soc., 134, 4132-4141. doi: 10.1021/ja208483v. Unique structural features of interconverting monomeric and dimeric g-quadruplexes adopted by a sequence from intron of n-myc gene . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
2lk7 DNA NMR Do NQ, Phan AT (2012) "Monomer-Dimer Equilibrium for the 5'-5' Stacking of Propeller-Type Parallel-Stranded G-Quadruplexes: NMR Structural Study." Chemistry. doi: 10.1002/chem.201103295. Monomer-dimer equilibrium for 5'-5' stacking of propeller-type parallel-stranded g-quadruplexes: NMR structural study . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
2lod DNA NMR Marusic M, Sket P, Bauer L, Viglasky V, Plavec J (2012) "Solution-state structure of an intramolecular G-quadruplex with propeller, diagonal and edgewise loops." Nucleic Acids Res., 40, 6946-6956. doi: 10.1093/nar/gks329. Solution-state structure of an intramolecular g-quadruplex with propeller, diagonal and edgewise loops . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUD, hybrid2, 3+1, 3(-PD+Lw)
2lpw DNA NMR Amrane S, Adrian M, Heddi B, Serero A, Nicolas A, Mergny JL, Phan AT (2012) "Formation of Pearl-Necklace Monomorphic G-Quadruplexes in the Human CEB25 Minisatellite." J.Am.Chem.Soc., 134, 5807-5816. doi: 10.1021/ja208993r. Human ceb25 minisatellite g-quadruplex . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
2lxq DNA NMR Kuryavyi V, Cahoon LA, Seifert HS, Patel DJ (2012) "RecA-Binding pilE G4 Sequence Essential for Pilin Antigenic Variation Forms Monomeric and 5' End-Stacked Dimeric Parallel G-Quadruplexes." Structure, 20, 2090-2102. doi: 10.1016/j.str.2012.09.013. Monomeric pile g-quadruplex DNA from neisseria gonorrhoeae . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
2lxv DNA NMR Kuryavyi V, Cahoon LA, Seifert HS, Patel DJ (2012) "RecA-Binding pilE G4 Sequence Essential for Pilin Antigenic Variation Forms Monomeric and 5' End-Stacked Dimeric Parallel G-Quadruplexes." Structure, 20, 2090-2102. doi: 10.1016/j.str.2012.09.013. Dimeric pil-e g-quadruplex DNA from neisseria gonorrhoeae, NMR 11 structures . 6 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, UUUU, parallel, 4+0, 3(-P-P-P), coaxial interfaces: 5'/5'
2lyg DNA NMR Gomez-Pinto I, Vengut-Climent E, Lucas R, Avino A, Eritja R, Gonzalez C, Morales JC (2013) "Carbohydrate-DNA interactions at G-quadruplexes: folding and stability changes by attaching sugars at the 5'-end." Chemistry, 19, 1920-1927. doi: 10.1002/chem.201203902. Fuc_tba . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
2m18 RNA NMR Martadinata H, Phan AT (2013) "Structure of Human Telomeric RNA (TERRA): Stacking of Two G-Quadruplex Blocks in K(+) Solution." Biochemistry, 52, 2176-2183. doi: 10.1021/bi301606u. Structure of stacked g-quadruplex formed by human terra sequence in potassium solution . 6 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, UUUU, parallel, 4+0, coaxial interfaces: 5'/5'
2m1g DNA NMR Martin-Pintado N, Yahyaee-Anzahaee M, Deleavey GF, Portella G, Orozco M, Damha MJ, Gonzalez C (2013) "Dramatic effect of furanose c2' substitution on structure and stability: directing the folding of the human telomeric quadruplex with a single fluorine atom." J.Am.Chem.Soc., 135, 5344-5347. doi: 10.1021/ja401954t. Parallel human telomeric quadruplex containing 2'f-ana substitutions . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0
2m27 DNA NMR Agrawal P, Hatzakis E, Guo K, Carver M, Yang D (2013) "Solution structure of the major G-quadruplex formed in the human VEGF promoter in K+: insights into loop interactions of the parallel G-quadruplexes." Nucleic Acids Res., 41, 10584-10592. doi: 10.1093/nar/gkt784. Major g-quadruplex structure formed in human vegf promoter, a monomeric parallel-stranded quadruplex . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
2m4p DNA NMR Mukundan VT, Phan AT (2013) "Bulges in G-Quadruplexes: Broadening the Definition of G-Quadruplex-Forming Sequences." J.Am.Chem.Soc., 135, 5017-5028. doi: 10.1021/ja310251r. Solution structure of an intramolecular propeller-type g-quadruplex containing a single bulge . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
2m53 DNA NMR Marusic M, Veedu RN, Wengel J, Plavec J (2013) "G-rich VEGF aptamer with locked and unlocked nucleic acid modifications exhibits a unique G-quadruplex fold." Nucleic Acids Res., 41, 9524-9536. doi: 10.1093/nar/gkt697. G-rich vegf aptamer with lna modifications . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 2(-P-P-P)
2m6v DNA NMR Dvorkin SA, Karsisiotis AI, Webba da Silva M (2018) "Encoding canonical DNA quadruplex structure." Sci Adv, 4, eaat3007. doi: 10.1126/sciadv.aat3007. Solution NMR structure of the d(gggttgggttttgggtggg) quadruplex in sodium conditions . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UDDU, anti-parallel:basket, 2+2, 2(-LwD+Ln)
2m6w DNA NMR Dvorkin SA, Karsisiotis AI, Webba da Silva M (2018) "Encoding canonical DNA quadruplex structure." Sci Adv, 4, eaat3007. doi: 10.1126/sciadv.aat3007. Solution NMR structure of the d(ggggttggggttttggggaagggg) quadruplex in sodium conditions . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UDDU, anti-parallel:basket, 2+2, 4(-LwD+Ln)
2m8z DNA NMR Lim KW, Phan AT (2013) "Structural basis of DNA quadruplex-duplex junction formation." Angew.Chem.Int.Ed.Engl., 52, 8566-8569. doi: 10.1002/anie.201302995. Structure of d[ggttggcgcgaagcattcgcgggttgg] quadruplex-duplex hybrid . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
2m90 DNA NMR Lim KW, Phan AT (2013) "Structural basis of DNA quadruplex-duplex junction formation." Angew.Chem.Int.Ed.Engl., 52, 8566-8569. doi: 10.1002/anie.201302995. Structure of d[gcgcgaagcattcgcggggaggtggggaaggg] quadruplex-duplex hybrid . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 2(-P-P-P)
2m91 DNA NMR Lim KW, Phan AT (2013) "Structural basis of DNA quadruplex-duplex junction formation." Angew.Chem.Int.Ed.Engl., 52, 8566-8569. doi: 10.1002/anie.201302995. Structure of d[gggaagggcgcgaagcattcgcgaggtagg] quadruplex-duplex hybrid . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UDDU, anti-parallel:basket, 2+2, 2(-LwD+Ln)
2m92 DNA NMR Lim KW, Phan AT (2013) "Structural basis of DNA quadruplex-duplex junction formation." Angew.Chem.Int.Ed.Engl., 52, 8566-8569. doi: 10.1002/anie.201302995. Structure of d[agggtgggtgctggggcgcgaagcattcgcgagg] quadruplex-duplex hybrid . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 2(-PX+P)
2m93 DNA NMR Lim KW, Phan AT (2013) "Structural basis of DNA quadruplex-duplex junction formation." Angew.Chem.Int.Ed.Engl., 52, 8566-8569. doi: 10.1002/anie.201302995. Structure of d[ttgggtgggcgcgaagcattcgcggggtgggt] quadruplex-duplex hybrid . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
2may DNA NMR Li Z, Lech C, Adrian M, Heddi B, Phan AT "Engineering G4: Towards effective incorporation of locked nucleic acid into G-quadruplexes." Structure of a g-quadruplex containing a single lna modification . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUDU, hybrid1, 3+1, 3(-P-Lw-Ln)
2mb2 DNA NMR Sengar A, Heddi B, Phan AT (2014) "Formation of g-quadruplexes in poly-g sequences: structure of a propeller-type parallel-stranded g-quadruplex formed by a g15 stretch." Biochemistry, 53, 7718-7723. doi: 10.1021/bi500990v. Parallel-stranded g-quadruplex in DNA poly-g stretches . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
2mb3 DNA-DNA inhibitor NMR Chung WJ, Heddi B, Tera M, Iida K, Nagasawa K, Phan AT (2013) "Solution structure of an intramolecular (3 + 1) human telomeric g-quadruplex bound to a telomestatin derivative." J.Am.Chem.Soc., 135, 13495-13501. doi: 10.1021/ja405843r. Solution structure of an intramolecular (3+1) human telomeric g-quadruplex bound to a telomestatin derivative . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUDU, hybrid1, 3+1, 3(-P-Lw-Ln)
2mb4 DNA NMR Adrian M, Ang DJ, Lech CJ, Heddi B, Nicolas A, Phan AT (2014) "Structure and Conformational Dynamics of a Stacked Dimeric G-Quadruplex Formed by the Human CEB1 Minisatellite." J.Am.Chem.Soc., 136, 6297-6305. doi: 10.1021/ja4125274. Solution structure of a stacked dimeric g-quadruplex formed by a segment of the human ceb1 minisatellite . 6 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, UUUU, parallel, 4+0, 2(-P-P-P), coaxial interfaces: 5'/5'
2mbj DNA NMR Lim KW, Ng VC, Martin-Pintado N, Heddi B, Phan AT (2013) "Structure of the human telomere in Na+ solution: an antiparallel (2+2) G-quadruplex scaffold reveals additional diversity." Nucleic Acids Res., 41, 10556-10562. doi: 10.1093/nar/gkt771. Structure of an antiparallel (2+2) g-quadruplex formed by human telomeric repeats in na+ solution (with g22-to-brg substitution) . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUDD, anti-parallel:basket2, 2+2, 3(+Ln+P+Lw)
2mcc DNA NMR Wilson T, Costa PJ, Felix V, Williamson MP, Thomas JA (2013) "Structural Studies on Dinuclear Ruthenium(II) Complexes That Bind Diastereoselectively to an Antiparallel Folded Human Telomere Sequence." J.Med.Chem., 56, 8674-8683. doi: 10.1021/jm401119b. Structural studies on dinuclear ruthenium(ii) complexes that bind diastereoselectively to an anti-parallel folded human telomere sequence . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UDDU, anti-parallel:basket, 2+2, 3(-LwD+Ln)
2mco DNA NMR Wilson T, Costa PJ, Felix V, Williamson MP, Thomas JA (2013) "Structural Studies on Dinuclear Ruthenium(II) Complexes That Bind Diastereoselectively to an Antiparallel Folded Human Telomere Sequence." J.Med.Chem., 56, 8674-8683. doi: 10.1021/jm401119b. Structural studies on dinuclear ruthenium(ii) complexes that bind diastereoselectively to an anti-parallel folded human telomere sequence . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UDDU, anti-parallel:basket, 2+2, 3(-LwD+Ln)
2mft DNA NMR Karsisiotis AI, Webba da Silva M "Solution NMR structure of the d(GGGTTTTGGGTGGGTTTTGGG) quadruplex in sodium conditions." Solution NMR structure of the d(gggttttgggtgggttttggg) quadruplex in sodium conditions . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UDDU, anti-parallel:basket, 2+2, 3(D+PD)
2mfu DNA NMR Karsisiotis A, Dillon P, Webba da Silva M "Solution NMR structure of quadruplex d(TGGGTTTGGGTTGGGTTTGGG) in sodium conditions." Solution NMR structure of quadruplex d(tgggtttgggttgggtttggg) in sodium conditions . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UDUU, hybrid3, 3+1, 2(-Lw-Ln-P)
2mgn DNA NMR Chung WJ, Heddi B, Hamon F, Teulade-Fichou MP, Phan AT (2014) "Solution Structure of a G-quadruplex Bound to the Bisquinolinium Compound Phen-DC3." Angew.Chem.Int.Ed.Engl., 53, 999-1002. doi: 10.1002/anie.201308063. Solution structure of a g-quadruplex bound to the bisquinolinium compound phen-dc3 . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 2(-P-P-P)
2ms6 DNA NMR Tawani A, Kumar A (2015) "Structural Insight into the interaction of Flavonoids with Human Telomeric Sequence." Sci Rep, 5, 17574. doi: 10.1038/srep17574. Human telomeric g-quadruplex DNA sequence (ttagggt)4 complexed with flavonoid quercetin . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0
2ms9 DNA NMR Chung WJ, Heddi B, Schmitt E, Lim KW, Mechulam Y, Phan AT (2015) "Structure of a left-handed DNA G-quadruplex." Proc.Natl.Acad.Sci.USA. Solution structure of a g-quadruplex . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 2(+P+P+P), negative twist
2mwz DNA NMR Cheong VV, Heddi B, Lech CJ, Phan AT (2015) "Xanthine and 8-oxoguanine in G-quadruplexes: formation of a GGXO tetrad." Nucleic Acids Res., 43, 10506-10514. doi: 10.1093/nar/gkv826. Xanthine and 8-oxoguanine in g-quadruplexes: formation of a g g x o tetrad . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUDU, hybrid1, 3+1, 3(-P-Lw-Ln)
2n21 hydrolase-DNA NMR Heddi B, Cheong VV, Martadinata H, Phan AT (2015) "Insights into G-quadruplex specific recognition by the DEAH-box helicase RHAU: Solution structure of a peptide-quadruplex complex." Proc.Natl.Acad.Sci.USA, 112, 9608-9613. doi: 10.1073/pnas.1422605112. Solution structure of complex between DNA g-quadruplex and g-quadruplex recognition domain of rhau . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
2n2d DNA NMR Brcic J, Plavec J (2015) "Solution structure of a DNA quadruplex containing ALS and FTD related GGGGCC repeat stabilized by 8-bromodeoxyguanosine substitution." Nucleic Acids Res., 43, 8590-8600. doi: 10.1093/nar/gkv815. Structure of DNA g-quadruplex adopted by als and ftd related ggggcc repeat with g21 to br-g21 substitution . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UDUD, anti-parallel:chair, 2+2, 4(+Ln+Lw+Ln)
2n3m DNA NMR Do NQ, Chung WJ, Truong THA, Heddi B, Phan AT "G-quadruplex structure of an anti-proliferative DNA sequence." G-quadruplex structure of an anti-proliferative DNA sequence . 4 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, UUUU, parallel, 4+0, 2(-P-P-P), coaxial interfaces: 3'/5'
2n4y DNA NMR De Nicola B, Lech CJ, Heddi B, Regmi S, Frasson I, Perrone R, Richter SN, Phan AT (2016) "Structure and possible function of a G-quadruplex in the long terminal repeat of the proviral HIV-1 genome." Nucleic Acids Res., 44, 6442-6451. doi: 10.1093/nar/gkw432. Structure and possible function of a g-quadruplex in the long terminal repeat of the proviral hiv-1 genome . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
2n60 DNA NMR Heddi B, Martin-Pintado N, Serimbetov Z, Kari TM, Phan AT (2016) "G-quadruplexes with (4n - 1) guanines in the G-tetrad core: formation of a G-triadwater complex and implication for small-molecule binding." Nucleic Acids Res., 44, 910-916. doi: 10.1093/nar/gkv1357. G-quadruplexes with (4n-1) guanines in the g-tetrad core: formation of a g-triad water complex and implication for small-molecule binding . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 2(-P-P-P)
2n6c DNA NMR Kumar A, Tawani A "Solution structure for quercetin complexed with c-myc G-quadruplex DNA." Solution structure for quercetin complexed with c-myc g-quadruplex DNA . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 2(-P-P-P)
2n9q DNA NMR Thevarpadam J, Bessi I, Binas O, Goncalves DP, Slavov C, Jonker HR, Richter C, Wachtveitl J, Schwalbe H, Heckel A (2016) "Photoresponsive Formation of an Intermolecular Minimal G-Quadruplex Motif." Angew.Chem.Int.Ed.Engl., 55, 2738-2742. doi: 10.1002/anie.201510269. Photoswitchable g-quadruplex . 4 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, UDUD, anti-parallel:chair, 2+2, coaxial interfaces: mixed
2o3m DNA NMR Phan AT, Kuryavyi VV, Burge S, Neidle S, Patel DJ (2007) "Structure of an unprecedented G-quadruplex scaffold in the human c-kit promoter." J.Am.Chem.Soc., 129, 4386-4392. doi: 10.1021/ja068739h. Monomeric g-DNA tetraplex from human c-kit promoter . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 2(-PX+P)
2o4f DNA X-ray (1.5 Å) Creze C, Rinaldi B, Haser R, Bouvet P, Gouet P (2007) "Structure of a d(TGGGGT) quadruplex crystallized in the presence of Li+ ions." Acta Crystallogr.,Sect.D, 63, 682-688. doi: 10.1107/S0907444907013315. Structure of a parallel-stranded guanine tetraplex crystallised with monovalent ions . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0
2rqj RNA NMR Mashima T, Matsugami A, Nishikawa F, Nishikawa S, Katahira M (2009) "Unique quadruplex structure and interaction of an RNA aptamer against bovine prion protein." Nucleic Acids Res., 37, 6249-6258. doi: 10.1093/nar/gkp647. Quadruplex structure of an RNA aptamer against bovine prion protein . 4 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, UUUU, parallel, 4+0, 2(-P-P-P), coaxial interfaces: 5'/5'
2rsk membrane protein-RNA NMR Mashima T, Nishikawa F, Kamatari YO, Fujiwara H, Saimura M, Nagata T, Kodaki T, Nishikawa S, Kuwata K, Katahira M (2013) "Anti-prion activity of an RNA aptamer and its structural basis." Nucleic Acids Res., 41, 1355-1362. doi: 10.1093/nar/gks1132. RNA aptamer against prion protein in complex with the partial binding peptide . 4 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, UUUU, parallel, 4+0, 2(-P-P-P), coaxial interfaces: 5'/5'
2ru7 membrane protein-RNA NMR Hayashi T, Oshima H, Mashima T, Nagata T, Katahira M, Kinoshita M (2014) "Binding of an RNA aptamer and a partial peptide of a prion protein: crucial importance of water entropy in molecular recognition." Nucleic Acids Res., 42, 6861-6875. doi: 10.1093/nar/gku382. Refined structure of RNA aptamer in complex with the partial binding peptide of prion protein . 4 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, UUUU, parallel, 4+0, 2(-P-P-P), coaxial interfaces: 5'/5'
2wcn DNA NMR Nielsen JT, Arar K, Petersen M (2009) "Solution Structure of a Locked Nucleic Acid Modified Quadruplex: Introducing the V4 Folding Topology." Angew.Chem.Int.Ed.Engl., 48, 3099. doi: 10.1002/ANIE.200806244. Solution structure of an lna-modified quadruplex . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UDUD, anti-parallel:chair, 2+2
352d DNA X-ray (0.95 Å) Phillips K, Dauter Z, Murchie AI, Lilley DM, Luisi B (1997) "The crystal structure of a parallel-stranded guanine tetraplex at 0.95 A resolution." J.Mol.Biol., 273, 171-182. doi: 10.1006/jmbi.1997.1292. The crystal structure of a parallel-stranded parallel-stranded guanine tetraplex at 0.95 angstrom resolution . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0
3cco DNA X-ray (2.2 Å) Parkinson GN, Cuenca F, Neidle S (2008) "Topology conservation and loop flexibility in quadruplex-drug recognition: crystal structures of inter- and intramolecular telomeric DNA quadruplex-drug complexes." J.Mol.Biol., 381, 1145-1156. doi: 10.1016/j.jmb.2008.06.022. Structural adaptation and conservation in quadruplex-drug recognition . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0
3cdm DNA X-ray (2.1 Å) Parkinson GN, Cuenca F, Neidle S (2008) "Topology conservation and loop flexibility in quadruplex-drug recognition: crystal structures of inter- and intramolecular telomeric DNA quadruplex-drug complexes." J.Mol.Biol., 381, 1145-1156. doi: 10.1016/j.jmb.2008.06.022. Structural adaptation and conservation in quadruplex-drug recognition . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
3ce5 DNA X-ray (2.5 Å) Campbell NH, Parkinson GN, Reszka AP, Neidle S (2008) "Structural basis of DNA quadruplex recognition by an acridine drug." J.Am.Chem.Soc., 130, 6722-6724. doi: 10.1021/ja8016973. A bimolecular parallel-stranded human telomeric quadruplex in complex with a 3,6,9-trisubstituted acridine molecule braco19 . 6 G-tetrads, 2 G4 helices, 2 G4 stems, UUUU, parallel, 4+0
3em2 DNA X-ray (2.3 Å) Campbell NH, Patel M, Tofa AB, Ghosh R, Parkinson GN, Neidle S (2009) "Selectivity in Ligand Recognition of G-Quadruplex Loops." Biochemistry, 48, 1675-1680. doi: 10.1021/bi802233v. A bimolecular anti-parallel-stranded oxytricha nova telomeric quadruplex in complex with a 3,6-disubstituted acridine bsu-6038 . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UDDU, anti-parallel:basket, 2+2
3eqw DNA X-ray (2.2 Å) Campbell NH, Patel M, Tofa AB, Ghosh R, Parkinson GN, Neidle S (2009) "Selectivity in Ligand Recognition of G-Quadruplex Loops." Biochemistry, 48, 1675-1680. doi: 10.1021/bi802233v. A bimolecular anti-parallel-stranded oxytricha nova telomeric quadruplex in complex with a 3,6-disubstituted acridine bsu-6042 in small unit cell . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UDDU, anti-parallel:basket, 2+2
3eru DNA X-ray (2.0 Å) Campbell NH, Patel M, Tofa AB, Ghosh R, Parkinson GN, Neidle S (2009) "Selectivity in Ligand Recognition of G-Quadruplex Loops." Biochemistry, 48, 1675-1680. doi: 10.1021/bi802233v. A bimolecular anti-parallel-stranded oxytricha nova telomeric quadruplex in complex with a 3,6-disubstituted acridine bsu-6045 . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UDDU, anti-parallel:basket, 2+2
3es0 DNA X-ray (2.2 Å) Campbell NH, Patel M, Tofa AB, Ghosh R, Parkinson GN, Neidle S (2009) "Selectivity in Ligand Recognition of G-Quadruplex Loops." Biochemistry, 48, 1675-1680. doi: 10.1021/bi802233v. A bimolecular anti-parallel-stranded oxytricha nova telomeric quadruplex in complex with a 3,6-disubstituted acridine bsu-6048 . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UDDU, anti-parallel:basket, 2+2
3et8 DNA X-ray (2.45 Å) Campbell NH, Patel M, Tofa AB, Ghosh R, Parkinson GN, Neidle S (2009) "Selectivity in Ligand Recognition of G-Quadruplex Loops." Biochemistry, 48, 1675-1680. doi: 10.1021/bi802233v. A bimolecular anti-parallel-stranded oxytricha nova telomeric quadruplex in complex with a 3,6-disubstituted acridine bsu-6054 . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UDDU, anti-parallel:basket, 2+2
3eui DNA X-ray (2.2 Å) Campbell NH, Patel M, Tofa AB, Ghosh R, Parkinson GN, Neidle S (2009) "Selectivity in Ligand Recognition of G-Quadruplex Loops." Biochemistry, 48, 1675-1680. doi: 10.1021/bi802233v. A bimolecular anti-parallel-stranded oxytricha nova telomeric quadruplex in complex with a 3,6-disubstituted acridine bsu-6042 in a large unit cell . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UDDU, anti-parallel:basket, 2+2
3eum DNA X-ray (1.78 Å) Campbell NH, Patel M, Tofa AB, Ghosh R, Parkinson GN, Neidle S (2009) "Selectivity in Ligand Recognition of G-Quadruplex Loops." Biochemistry, 48, 1675-1680. doi: 10.1021/bi802233v. A bimolecular anti-parallel-stranded oxytricha nova telomeric quadruplex in complex with a 3,6-disubstituted acridine bsu-6066 . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UDDU, anti-parallel:basket, 2+2
3ibk RNA X-ray (2.2 Å) Collie GW, Haider SM, Neidle S, Parkinson GN (2010) "A crystallographic and modelling study of a human telomeric RNA (TERRA) quadruplex." Nucleic Acids Res., 38, 5569-5580. doi: 10.1093/nar/gkq259. Crystal structure of a telomeric RNA quadruplex . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0
3mij RNA X-ray (2.6 Å) Collie GW, Sparapani S, Parkinson GN, Neidle S (2011) "Structural basis of telomeric RNA quadruplex-acridine ligand recognition." J.Am.Chem.Soc., 133, 2721-2728. doi: 10.1021/ja109767y. Crystal structure of a telomeric RNA g-quadruplex complexed with an acridine-based ligand. . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0
3nyp DNA X-ray (1.179 Å) Campbell NH, Smith DL, Reszka AP, Neidle S, O'Hagan D (2011) "Fluorine in medicinal chemistry: beta-fluorination of peripheral pyrrolidines attached to acridine ligands affects their interactions with G-quadruplex DNA." Org.Biomol.Chem., 9, 1328-1331. doi: 10.1039/c0ob00886a. A bimolecular anti-parallel-stranded oxytricha nova telomeric quadruplex in complex with a 3,6-disubstituted acridine ligand containing bis-3-fluoropyrrolidine end side chains . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UDDU, anti-parallel:basket, 2+2
3nz7 DNA X-ray (1.1 Å) Campbell NH, Smith DL, Reszka AP, Neidle S, O'Hagan D (2011) "Fluorine in medicinal chemistry: beta-fluorination of peripheral pyrrolidines attached to acridine ligands affects their interactions with G-quadruplex DNA." Org.Biomol.Chem., 9, 1328-1331. doi: 10.1039/c0ob00886a. A bimolecular anti-parallel-stranded oxytricha nova telomeric quadruplex in complex with a 3,6-disubstituted acridine ligand containing bis-3-fluoropyrrolidine end side chains . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UDDU, anti-parallel:basket, 2+2
3qcr DNA X-ray (3.2 Å) Collie GW, Sparapani S, Parkinson GN, Neidle S (2011) "Structural basis of telomeric RNA quadruplex-acridine ligand recognition." J.Am.Chem.Soc., 133, 2721-2728. doi: 10.1021/ja109767y. Incomplete structural model of a human telomeric DNA quadruplex-acridine complex. . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0
3qlp hydrolase-hydrolase inhibitor-DNA X-ray (2.14 Å) Russo Krauss I, Merlino A, Giancola C, Randazzo A, Mazzarella L, Sica F (2011) "Thrombin-aptamer recognition: a revealed ambiguity." Nucleic Acids Res., 39, 7858-7867. doi: 10.1093/nar/gkr522. X-ray structure of the complex between human alpha thrombin and a modified thrombin binding aptamer (mtba) . 2 G-tetrads, 1 G4 helix, 1 G4 stem, DDUD, ---???---, 1+3, 2(+Lm+Lw+Ln)
3qsc DNA X-ray (2.4 Å) Campbell NH, Karim NH, Parkinson GN, Gunaratnam M, Petrucci V, Todd AK, Vilar R, Neidle S (2012) "Molecular basis of structure-activity relationships between salphen metal complexes and human telomeric DNA quadruplexes." J.Med.Chem., 55, 209-222. doi: 10.1021/jm201140v. The first crystal structure of a human telomeric g-quadruplex DNA bound to a metal-containing ligand (a copper complex) . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0
3qsf DNA X-ray (2.4 Å) Campbell NH, Karim NH, Parkinson GN, Gunaratnam M, Petrucci V, Todd AK, Vilar R, Neidle S (2012) "Molecular basis of structure-activity relationships between salphen metal complexes and human telomeric DNA quadruplexes." J.Med.Chem., 55, 209-222. doi: 10.1021/jm201140v. The first crystal structure of a human telomeric g-quadruplex DNA bound to a metal-containing ligand (a nickel complex) . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0
3qxr DNA X-ray (1.62 Å) Wei D, Parkinson GN, Reszka AP, Neidle S (2012) "Crystal structure of a c-kit promoter quadruplex reveals the structural role of metal ions and water molecules in maintaining loop conformation." Nucleic Acids Res., 40, 4691-4700. doi: 10.1093/nar/gks023. Crystal structure of the brominated ckit-1 proto-oncogene promoter quadruplex DNA . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 2(-PX+P)
3r6r DNA-antibiotic X-ray (2.4 Å) Bazzicalupi C, Ferraroni M, Bilia AR, Scheggi F, Gratteri P (2013) "The crystal structure of human telomeric DNA complexed with berberine: an interesting case of stacked ligand to G-tetrad ratio higher than 1:1." Nucleic Acids Res., 41, 632-638. doi: 10.1093/nar/gks1001. Structure of the complex of an intramolecular human telomeric DNA with berberine formed in k+ solution . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
3sc8 DNA X-ray (2.302 Å) Collie GW, Promontorio R, Hampel SM, Micco M, Neidle S, Parkinson GN (2012) "Structural basis for telomeric g-quadruplex targeting by naphthalene diimide ligands." J.Am.Chem.Soc., 134, 2723-2731. doi: 10.1021/ja2102423. Crystal structure of an intramolecular human telomeric DNA g-quadruplex bound by the naphthalene diimide bmsg-sh-3 . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
3t5e DNA X-ray (2.1 Å) Collie GW, Promontorio R, Hampel SM, Micco M, Neidle S, Parkinson GN (2012) "Structural basis for telomeric g-quadruplex targeting by naphthalene diimide ligands." J.Am.Chem.Soc., 134, 2723-2731. doi: 10.1021/ja2102423. Crystal structure of an intramolecular human telomeric DNA g-quadruplex bound by the naphthalene diimide bmsg-sh-4 . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
3tvb DNA-antibiotic X-ray (1.08 Å) Clark GR, Pytel PD, Squire CJ (2012) "The high-resolution crystal structure of a parallel intermolecular DNA G-4 quadruplex/drug complex employing syn glycosyl linkages." Nucleic Acids Res., 40, 5731-5738. doi: 10.1093/nar/gks193. A highly symmetric DNA g-4 quadruplex-drug complex . 8 G-tetrads, 2 G4 helices, 2 G4 stems, UUUU, parallel, 4+0
3uyh DNA X-ray (1.95 Å) Micco M, Collie GW, Dale AG, Ohnmacht SA, Pazitna I, Gunaratnam M, Reszka AP, Neidle S (2013) "Structure-based design and evaluation of naphthalene diimide g-quadruplex ligands as telomere targeting agents in pancreatic cancer cells." J.Med.Chem., 56, 2959-2974. doi: 10.1021/jm301899y. Crystal structure of an intramolecular human telomeric DNA g-quadruplex bound by the naphthalene diimide compound, mm41 . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
4da3 DNA X-ray (2.4 Å) Micco M, Collie GW, Dale AG, Ohnmacht SA, Pazitna I, Gunaratnam M, Reszka AP, Neidle S (2013) "Structure-based design and evaluation of naphthalene diimide g-quadruplex ligands as telomere targeting agents in pancreatic cancer cells." J.Med.Chem., 56, 2959-2974. doi: 10.1021/jm301899y. Crystal structure of an intramolecular human telomeric DNA g-quadruplex 21-mer bound by the naphthalene diimide compound mm41. . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
4daq DNA X-ray (2.754 Å) Micco M, Collie GW, Dale AG, Ohnmacht SA, Pazitna I, Gunaratnam M, Reszka AP, Neidle S (2013) "Structure-based design and evaluation of naphthalene diimide g-quadruplex ligands as telomere targeting agents in pancreatic cancer cells." J.Med.Chem., 56, 2959-2974. doi: 10.1021/jm301899y. Crystal structure of an intramolecular human telomeric DNA g-quadruplex 21-mer bound by the naphthalene diimide compound bmsg-sh-3 . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
4dih hydrolase-hydrolase inhibitor-DNA X-ray (1.8 Å) Russo Krauss I, Merlino A, Randazzo A, Novellino E, Mazzarella L, Sica F (2012) "High-resolution structures of two complexes between thrombin and thrombin-binding aptamer shed light on the role of cations in the aptamer inhibitory activity." Nucleic Acids Res., 40, 8119-8128. doi: 10.1093/nar/gks512. X-ray structure of the complex between human alpha thrombin and thrombin binding aptamer in the presence of sodium ions . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
4dii hydrolase-hydrolase inhibitor-DNA X-ray (2.05 Å) Russo Krauss I, Merlino A, Randazzo A, Novellino E, Mazzarella L, Sica F (2012) "High-resolution structures of two complexes between thrombin and thrombin-binding aptamer shed light on the role of cations in the aptamer inhibitory activity." Nucleic Acids Res., 40, 8119-8128. doi: 10.1093/nar/gks512. X-ray structure of the complex between human alpha thrombin and thrombin binding aptamer in the presence of potassium ions . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
4fxm DNA X-ray (1.651 Å) Nicoludis JM, Miller ST, Jeffrey PD, Barrett SP, Rablen PR, Lawton TJ, Yatsunyk LA (2012) "Optimized End-Stacking Provides Specificity of N-Methyl Mesoporphyrin IX for Human Telomeric G-Quadruplex DNA." J.Am.Chem.Soc., 134, 20446-20456. doi: 10.1021/ja3088746. Crystal structure of the complex of a human telomeric repeat g-quadruplex and n-methyl mesoporphyrin ix (p21212) . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
4g0f DNA X-ray (2.15 Å) Nicoludis JM, Miller ST, Jeffrey PD, Barrett SP, Rablen PR, Lawton TJ, Yatsunyk LA (2012) "Optimized End-Stacking Provides Specificity of N-Methyl Mesoporphyrin IX for Human Telomeric G-Quadruplex DNA." J.Am.Chem.Soc., 134, 20446-20456. doi: 10.1021/ja3088746. Crystal structure of the complex of a human telomeric repeat g-quadruplex and n-methyl mesoporphyrin ix (p6) . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
4h29 DNA X-ray (1.991 Å) Wei D, Todd AK, Zloh M, Gunaratnam M, Parkinson GN, Neidle S (2013) "Crystal Structure of a Promoter Sequence in the B-raf Gene Reveals an Intertwined Dimer Quadruplex." J.Am.Chem.Soc., 135, 19319-19329. doi: 10.1021/ja4101358. B-raf dimer DNA quadruplex . 7 G-tetrads, 1 G4 helix, 3 G4 stems, 1 G4 coaxial stack, UDUD, anti-parallel:chair, 2+2; UUUU, parallel, 4+0, coaxial interfaces: mixed; 3'/5'
4i7y hydrolase-hydrolase inhibitor-DNA X-ray (2.4 Å) Russo Krauss I, Pica A, Merlino A, Mazzarella L, Sica F (2013) "Duplex-quadruplex motifs in a peculiar structural organization cooperatively contribute to thrombin binding of a DNA aptamer." Acta Crystallogr.,Sect.D, 69, 2403-2411. doi: 10.1107/S0907444913022269. Crystal structure of human alpha thrombin in complex with a 27-mer aptamer bound to exosite ii . 1 G-tetrad
4kzd immune system-RNA X-ray (2.186 Å) Huang H, Suslov NB, Li NS, Shelke SA, Evans ME, Koldobskaya Y, Rice PA, Piccirilli JA (2014) "A G-quadruplex-containing RNA activates fluorescence in a GFP-like fluorophore." Nat.Chem.Biol., 10, 686-691. doi: 10.1038/nchembio.1561. Crystal structure of an RNA aptamer in complex with fluorophore and fab . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UUDD, anti-parallel:basket2, 2+2, 2(-PD+P)
4kze immune system-RNA X-ray (2.404 Å) Huang H, Suslov NB, Li NS, Shelke SA, Evans ME, Koldobskaya Y, Rice PA, Piccirilli JA (2014) "A G-quadruplex-containing RNA activates fluorescence in a GFP-like fluorophore." Nat.Chem.Biol., 10, 686-691. doi: 10.1038/nchembio.1561. Crystal structure of an RNA aptamer in complex with fab . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UUDD, anti-parallel:basket2, 2+2, 2(-PD+P)
4l0a DNA, RNA X-ray (1.7 Å) Russo Krauss I, Parkinson GN, Merlino A, Mattia CA, Randazzo A, Novellino E, Mazzarella L, Sica F (2014) "A regular thymine tetrad and a peculiar supramolecular assembly in the first crystal structure of an all-LNA G-quadruplex." Acta Crystallogr.,Sect.D, 70, 362-370. doi: 10.1107/S1399004713028095. X-ray structure of an all lna quadruplex . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0
4lz1 hydrolase-hydrolase inhibitor-DNA X-ray (1.65 Å) Pica A, Russo Krauss I, Merlino A, Nagatoishi S, Sugimoto N, Sica F (2013) "Dissecting the contribution of thrombin exosite I in the recognition of thrombin binding aptamer." Febs J., 280, 6581-6588. doi: 10.1111/febs.12561. X-ray structure of the complex between human thrombin and the tba deletion mutant lacking thymine 12 nucleobase . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
4lz4 hydrolase-hydrolase inhibitor-DNA X-ray (2.56 Å) Pica A, Russo Krauss I, Merlino A, Nagatoishi S, Sugimoto N, Sica F (2013) "Dissecting the contribution of thrombin exosite I in the recognition of thrombin binding aptamer." Febs J., 280, 6581-6588. doi: 10.1111/febs.12561. X-ray structure of the complex between human thrombin and the tba deletion mutant lacking thymine 3 nucleobase . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
4ni7 cytokine-DNA X-ray (2.4 Å) Gelinas AD, Davies DR, Edwards TE, Rohloff JC, Carter JD, Zhang C, Gupta S, Ishikawa Y, Hirota M, Nakaishi Y, Jarvis TC, Janjic N (2014) "Crystal structure of interleukin-6 in complex with a modified nucleic Acid ligand." J.Biol.Chem., 289, 8720-8734. doi: 10.1074/jbc.M113.532697. Crystal structure of human interleukin 6 in complex with a modified nucleotide aptamer (somamer sl1025) . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw)
4ni9 cytokine-DNA X-ray (2.55 Å) Gelinas AD, Davies DR, Edwards TE, Rohloff JC, Carter JD, Zhang C, Gupta S, Ishikawa Y, Hirota M, Nakaishi Y, Jarvis TC, Janjic N (2014) "Crystal structure of interleukin-6 in complex with a modified nucleic Acid ligand." J.Biol.Chem., 289, 8720-8734. doi: 10.1074/jbc.M113.532697. Crystal structure of human interleukin 6 in complex with a modified nucleotide aptamer (somamer sl1025), form 2 . 4 G-tetrads, 2 G4 helices, 2 G4 stems, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
4p1d DNA X-ray (1.55 Å) Ferraroni M, Bazzicalupi C, Gratteri P, Bilia AR, Sissi C "Crystal Structure of the complex of a bimolecular human telomeric DNA with Coptisine." Structure of the complex of a bimolecular human telomeric DNA with coptisine . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0
4q9q RNA X-ray (2.45 Å) Huang H, Suslov NB, Li NS, Shelke SA, Evans ME, Koldobskaya Y, Rice PA, Piccirilli JA (2014) "A G-quadruplex-containing RNA activates fluorescence in a GFP-like fluorophore." Nat.Chem.Biol., 10, 686-691. doi: 10.1038/nchembio.1561. Crystal structure of an RNA aptamer bound to bromo-ligand analog in complex with fab . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UUDD, anti-parallel:basket2, 2+2, 2(-PD+P)
4q9r RNA-immune system X-ray (3.12 Å) Huang H, Suslov NB, Li NS, Shelke SA, Evans ME, Koldobskaya Y, Rice PA, Piccirilli JA (2014) "A G-quadruplex-containing RNA activates fluorescence in a GFP-like fluorophore." Nat.Chem.Biol., 10, 686-691. doi: 10.1038/nchembio.1561. Crystal structure of an RNA aptamer bound to trifluoroethyl-ligand analog in complex with fab . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UUDD, anti-parallel:basket2, 2+2, 2(-PD+P)
4r44 DNA X-ray (2.695 Å) Mandal PK, Collie GW, Kauffmann B, Huc I (2014) "Racemic DNA crystallography." Angew.Chem.Int.Ed.Engl., 53, 14424-14427. doi: 10.1002/anie.201409014. Racemic crystal structure of a tetramolecular DNA g-quadruplex . 8 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, UUUU, parallel, 4+0, coaxial interfaces: 5'/5'
4r45 DNA X-ray (1.9 Å) Mandal PK, Collie GW, Kauffmann B, Huc I (2014) "Racemic DNA crystallography." Angew.Chem.Int.Ed.Engl., 53, 14424-14427. doi: 10.1002/anie.201409014. Racemic crystal structure of a bimolecular DNA g-quadruplex (p-1) . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UDDU, anti-parallel:basket, 2+2
4r47 DNA X-ray (1.85 Å) Mandal PK, Collie GW, Kauffmann B, Huc I (2014) "Racemic DNA crystallography." Angew.Chem.Int.Ed.Engl., 53, 14424-14427. doi: 10.1002/anie.201409014. Racemic crystal structure of a bimolecular DNA g-quadruplex (p21-n) . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UDDU, anti-parallel:basket, 2+2
4rj1 RNA X-ray (0.92 Å) Fyfe AC, Dunten PW, Martick MM, Scott WG (2015) "Structural Variations and Solvent Structure of r(UGGGGU) Quadruplexes Stabilized by Sr(2+) Ions." J.Mol.Biol., 427, 2205-2219. doi: 10.1016/j.jmb.2015.03.022. Structural variations and solvent structure of uggggu quadruplexes stabilized by sr2+ ions . 8 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, UUUU, parallel, 4+0, coaxial interfaces: 5'/5'
4rkv RNA X-ray (0.88 Å) Fyfe AC, Dunten PW, Martick MM, Scott WG (2015) "Structural Variations and Solvent Structure of r(UGGGGU) Quadruplexes Stabilized by Sr(2+) Ions." J.Mol.Biol., 427, 2205-2219. doi: 10.1016/j.jmb.2015.03.022. Structural variations and solvent structure of uggggu quadruplexes stabilized by sr2+ ions . 8 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, UUUU, parallel, 4+0, coaxial interfaces: 5'/5'
4rne RNA X-ray (1.01 Å) Fyfe AC, Dunten PW, Martick MM, Scott WG (2015) "Structural Variations and Solvent Structure of r(UGGGGU) Quadruplexes Stabilized by Sr(2+) Ions." J.Mol.Biol., 427, 2205-2219. doi: 10.1016/j.jmb.2015.03.022. Structural variations and solvent structure of uggggu quadruplexes stabilized by sr2+ ions . 8 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, UUUU, parallel, 4+0, coaxial interfaces: 5'/5'
4ts0 RNA X-ray (2.8 Å) Warner KD, Chen MC, Song W, Strack RL, Thorn A, Jaffrey SR, Ferre-D'Amare AR (2014) "Structural basis for activity of highly efficient RNA mimics of green fluorescent protein." Nat.Struct.Mol.Biol., 21, 658-663. doi: 10.1038/nsmb.2865. Crystal structure of the spinach RNA aptamer in complex with dfhbi, barium ions . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UUDD, anti-parallel:basket2, 2+2
4ts2 RNA X-ray (2.884 Å) Warner KD, Chen MC, Song W, Strack RL, Thorn A, Jaffrey SR, Ferre-D'Amare AR (2014) "Structural basis for activity of highly efficient RNA mimics of green fluorescent protein." Nat.Struct.Mol.Biol., 21, 658-663. doi: 10.1038/nsmb.2865. Crystal structure of the spinach RNA aptamer in complex with dfhbi, magnesium ions . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UUDD, anti-parallel:basket2, 2+2
4u5m DNA X-ray (1.5 Å) Chung WJ, Heddi B, Schmitt E, Lim KW, Mechulam Y, Phan AT (2015) "Structure of a left-handed DNA G-quadruplex." Proc.Natl.Acad.Sci.USA, 112, 2729-2733. doi: 10.1073/pnas.1418718112. Structure of a left-handed DNA g-quadruplex . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 2(+P+P+P), negative twist
4u92 DNA X-ray (1.5 Å) Zhang D, Huang T, Lukeman PS, Paukstelis PJ (2014) "Crystal structure of a DNA/Ba2+ G-quadruplex containing a water-mediated C-tetrad." Nucleic Acids Res., 42, 13422-13429. doi: 10.1093/nar/gku1122. Crystal structure of a DNA-ba2+ g-quadruplex containing a water-mediated c-tetrad . 8 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, UUUU, parallel, 4+0, coaxial interfaces: 3'/3'
4wb2 DNA-RNA hybrid X-ray (1.8 Å) Yatime L, Maasch C, Hoehlig K, Klussmann S, Andersen GR, Vater A (2015) "Structural basis for the targeting of complement anaphylatoxin C5a using a mixed L-RNA/L-DNA aptamer." Nat Commun, 6, 6481. doi: 10.1038/ncomms7481. Crystal structure of the mirror-image l-RNA-l-DNA aptamer nox-d20 in complex with mouse c5a complement anaphylatoxin . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 2(-P-P-P)
4wb3 DNA-RNA hybrid X-ray (2.0 Å) Yatime L, Maasch C, Hoehlig K, Klussmann S, Andersen GR, Vater A (2015) "Structural basis for the targeting of complement anaphylatoxin C5a using a mixed L-RNA/L-DNA aptamer." Nat Commun, 6, 6481. doi: 10.1038/ncomms7481. Crystal structure of the mirror-image l-RNA-l-DNA aptamer nox-d20 in complex with mouse c5a-desarg complement anaphylatoxin . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 2(-P-P-P)
4wo2 DNA X-ray (1.82 Å) Wei D, Parkinson GN, Neidle S "CRYSTAL STRUCTURE OF HUMAN NATIVE CKIT-1 PROTO-ONCOGENE PROMOTER QUADRUPLEX DNA." Crystal structure of human native ckit proto-oncogene promoter quadruplex DNA . 6 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, UUUU, parallel, 4+0, 2(-PX+P), coaxial interfaces: 5'/5'-SEPARATED
4wo3 DNA X-ray (2.73 Å) Wei D, Neidle S "THE SECOND C-KIT1 DNA QUADRUPLEX CRYSTAL STRUCTURE." The second c-kit DNA quadruplex crystal structure . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 2(-PX+P)
4xk0 RNA X-ray (1.08 Å) Chen MC, Murat P, Abecassis K, Ferre-D'Amare AR, Balasubramanian S (2015) "Insights into the mechanism of a G-quadruplex-unwinding DEAH-box helicase." Nucleic Acids Res., 43, 2223-2231. doi: 10.1093/nar/gkv051. Crystal structure of a tetramolecular RNA g-quadruplex in potassium . 8 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, UUUU, parallel, 4+0, coaxial interfaces: 5'/5'
5bjo RNA X-ray (2.35 Å) Warner KD, Sjekloca L, Song W, Filonov GS, Jaffrey SR, Ferre-D'Amare AR (2017) "A homodimer interface without base pairs in an RNA mimic of red fluorescent protein." Nat. Chem. Biol., 13, 1195-1201. doi: 10.1038/nchembio.2475. Crystal structure of the corn RNA aptamer in complex with dfho, site-specific 5-iodo-u . 4 G-tetrads, 2 G4 helices, 2 G4 stems, UUUU, parallel, 4+0, 2(-P-P-P)
5bjp RNA X-ray (2.51 Å) Warner KD, Sjekloca L, Song W, Filonov GS, Jaffrey SR, Ferre-D'Amare AR (2017) "A homodimer interface without base pairs in an RNA mimic of red fluorescent protein." Nat. Chem. Biol., 13, 1195-1201. doi: 10.1038/nchembio.2475. Crystal structure of the corn RNA aptamer in complex with dfho, iridium hexammine soak . 4 G-tetrads, 2 G4 helices, 2 G4 stems, UUUU, parallel, 4+0, 2(-P-P-P)
5ccw drug-DNA X-ray (1.89 Å) Bazzicalupi C, Ferraroni M, Papi F, Massai L, Bertrand B, Messori L, Gratteri P, Casini A (2016) "Determinants for Tight and Selective Binding of a Medicinal Dicarbene Gold(I) Complex to a Telomeric DNA G-Quadruplex: a Joint ESI MS and XRD Investigation." Angew.Chem.Int.Ed.Engl., 55, 4256-4259. doi: 10.1002/anie.201511999. Structure of the complex of a human telomeric DNA with au(caffein-2-ylidene)2 . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P)
5cdb DNA X-ray (1.7 Å) Ferraroni M, Bazzicalupi C, Papi F, Fiorillo G, Guaman-Ortiz LM, Nocentini A, Scovassi AI, Lombardi P, Gratteri P (2016) "Solution and Solid-State Analysis of Binding of 13-Substituted Berberine Analogues to Human Telomeric G-quadruplexes." Chem Asian J, 11, 1107-1115. doi: 10.1002/asia.201600116. Structure of the complex of a bimolecular human telomeric DNA with a 13-diphenylalkyl berberine derivative . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0
5cmx hydrolase X-ray (2.98 Å) Russo Krauss I, Spiridonova V, Pica A, Napolitano V, Sica F (2016) "Different duplex/quadruplex junctions determine the properties of anti-thrombin aptamers with mixed folding." Nucleic Acids Res., 44, 983-991. doi: 10.1093/nar/gkv1384. X-ray structure of the complex between human alpha thrombin and a duplex-quadruplex 31-mer DNA aptamer . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
5de5 RNA binding protein-RNA X-ray (3.0 Å) Vasilyev N, Polonskaia A, Darnell JC, Darnell RB, Patel DJ, Serganov A (2015) "Crystal structure reveals specific recognition of a G-quadruplex RNA by a beta-turn in the RGG motif of FMRP." Proc.Natl.Acad.Sci.USA, 112, E5391-E5400. doi: 10.1073/pnas.1515737112. Crystal structure of the complex between human fmrp rgg motif and g-quadruplex RNA. . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 2(-P-P-P)
5de8 RNA binding protein-RNA X-ray (3.1 Å) Vasilyev N, Polonskaia A, Darnell JC, Darnell RB, Patel DJ, Serganov A (2015) "Crystal structure reveals specific recognition of a G-quadruplex RNA by a beta-turn in the RGG motif of FMRP." Proc.Natl.Acad.Sci.USA, 112, E5391-E5400. doi: 10.1073/pnas.1515737112. Crystal structure of the complex between human fmrp rgg motif and g-quadruplex RNA, iridium hexammine bound form. . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 2(-P-P-P)
5dea RNA binding protein-RNA X-ray (2.8 Å) Vasilyev N, Polonskaia A, Darnell JC, Darnell RB, Patel DJ, Serganov A (2015) "Crystal structure reveals specific recognition of a G-quadruplex RNA by a beta-turn in the RGG motif of FMRP." Proc.Natl.Acad.Sci.USA, 112, E5391-E5400. doi: 10.1073/pnas.1515737112. Crystal structure of the complex between human fmrp rgg motif and g-quadruplex RNA, cesium bound form. . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 2(-P-P-P)
5dww DNA X-ray (2.79 Å) Russo Krauss I, Ramaswamy S, Neidle S, Haider S, Parkinson GN (2016) "Structural Insights into the Quadruplex-Duplex 3' Interface Formed from a Telomeric Repeat: A Potential Molecular Target." J.Am.Chem.Soc., 138, 1226-1233. doi: 10.1021/jacs.5b10492. Structural insights into the quadruplex-duplex 3' interface formed from a telomeric repeat - ttloop . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
5dwx DNA X-ray (2.71 Å) Russo Krauss I, Ramaswamy S, Neidle S, Haider S, Parkinson GN (2016) "Structural Insights into the Quadruplex-Duplex 3' Interface Formed from a Telomeric Repeat: A Potential Molecular Target." J.Am.Chem.Soc., 138, 1226-1233. doi: 10.1021/jacs.5b10492. Structural insights into the quadruplex-duplex 3' interface formed from a telomeric repeat - tloop . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
5ew1 protein-DNA X-ray (2.95 Å) Pica A, Russo Krauss I, Parente V, Tateishi-Karimata H, Nagatoishi S, Tsumoto K, Sugimoto N, Sica F (2017) "Through-bond effects in the ternary complexes of thrombin sandwiched by two DNA aptamers." Nucleic Acids Res., 45, 461-469. doi: 10.1093/nar/gkw1113. Human thrombin sandwiched between two DNA aptamers: hd22 and hd1-deltat3 . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
5ew2 protein-DNA X-ray (3.59 Å) Pica A, Russo Krauss I, Parente V, Tateishi-Karimata H, Nagatoishi S, Tsumoto K, Sugimoto N, Sica F (2017) "Through-bond effects in the ternary complexes of thrombin sandwiched by two DNA aptamers." Nucleic Acids Res., 45, 461-469. doi: 10.1093/nar/gkw1113. Human thrombin sandwiched between two DNA aptamers: hd22 and hd1-deltat12 . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
5hix DNA X-ray (2.48 Å) Mandal PK, Baptiste B, Langlois d'Estaintot B, Kauffmann B, Huc I (2016) "Multivalent Interactions between an Aromatic Helical Foldamer and a DNA G-Quadruplex in the Solid State." Chembiochem, 17, 1911-1914. doi: 10.1002/cbic.201600281. Cocrystal structure of an anti-parallel DNA g-quadruplex and a tetra-quinoline foldamer . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UDDU, anti-parallel:basket, 2+2
5i2v DNA NMR Kerkour A, Marquevielle J, Ivashchenko S, Yatsunyk LA, Mergny JL, Salgado GF (2017) "High-resolution three-dimensional NMR structure of the KRAS proto-oncogene promoter reveals key features of a G-quadruplex involved in transcriptional regulation." J. Biol. Chem., 292, 8082-8091. doi: 10.1074/jbc.M117.781906. NMR structure of a new g-quadruplex forming sequence within the kras proto-oncogene promoter region . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
5j05 DNA NMR Dvorkin SA, Karsisiotis AI, Webba da Silva M (2018) "Encoding canonical DNA quadruplex structure." Sci Adv, 4, eaat3007. doi: 10.1126/sciadv.aat3007. Diy g-quadruplexes: solution structure of d(gggtttgggttttgggaggg) in sodium . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UDDU, anti-parallel:basket, 2+2, 3(-LwD+Ln)
5j4p DNA NMR Dvorkin SA, Karsisiotis AI, Webba da Silva M (2018) "Encoding canonical DNA quadruplex structure." Sci Adv, 4, eaat3007. doi: 10.1126/sciadv.aat3007. Diy g-quadruplexes: solution structure of d(ggtttggttttggtttgg) in sodium . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UDDU, anti-parallel:basket, 2+2, 2(-LwD+Ln)
5j4w DNA NMR Dvorkin SA, Karsisiotis AI, Webba da Silva M (2018) "Encoding canonical DNA quadruplex structure." Sci Adv, 4, eaat3007. doi: 10.1126/sciadv.aat3007. Diy g-quadruplexes: solution structure of d(ggtttggttttggttgg) in sodium . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UDDU, anti-parallel:basket, 2+2, 2(-LwD+Ln)
5j6u DNA NMR Dvorkin SA, Karsisiotis AI, Webba da Silva M (2018) "Encoding canonical DNA quadruplex structure." Sci Adv, 4, eaat3007. doi: 10.1126/sciadv.aat3007. Diy g-quadruplexes: solution structure of d(ggggtttggggttttggggaagggg) in sodium . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UDDU, anti-parallel:basket, 2+2, 4(-LwD+Ln)
5lig DNA NMR Kotar A, Wang B, Shivalingam A, Gonzalez-Garcia J, Vilar R, Plavec J (2016) "NMR Structure of a Triangulenium-Based Long-Lived Fluorescence Probe Bound to a G-Quadruplex." Angew.Chem.Int.Ed.Engl., 55, 12508-12511. doi: 10.1002/anie.201606877. G-quadruplex formed at the 5'-end of nheiii_1 element in human c-myc promoter bound to triangulenium based fluorescence probe daota-m2 . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
5lqg DNA NMR Galer P, Wang B, Sket P, Plavec J (2016) "Reversible pH Switch of Two-Quartet G-Quadruplexes Formed by Human Telomere." Angew.Chem.Int.Ed.Engl., 55, 1993-1997. doi: 10.1002/anie.201507569. A two-quartet g-quadruplex formed by human telomere in kcl solution at neutral ph . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UDDU, anti-parallel:basket, 2+2, 2(-LwD+Ln)
5lqh DNA NMR Galer P, Wang B, Sket P, Plavec J (2016) "Reversible pH Switch of Two-Quartet G-Quadruplexes Formed by Human Telomere." Angew.Chem.Int.Ed.Engl., 55, 1993-1997. doi: 10.1002/anie.201507569. A two-quartet g-quadruplex formed by human telomere in kcl solution at ph 5.0 . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UUDD, anti-parallel:basket2, 2+2, 2(+LnD-Lw)
5ls8 DNA X-ray (1.78 Å) McQuaid K, Abell H, Gurung SP, Allan DR, Winter G, Sorensen T, Cardin DJ, Brazier JA, Cardin CJ, Hall JP (2019) "Structural Studies Reveal Enantiospecific Recognition of a DNA G-Quadruplex by a Ruthenium Polypyridyl Complex." Angew.Chem.Int.Ed.Engl., 58, 9881-9885. doi: 10.1002/anie.201814502. Light-activated ruthenium complex bound to a DNA quadruplex . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UDUD, anti-parallel:chair, 2+2
5m2l DNA NMR Kocman V, Plavec J (2017) "Tetrahelical structural family adopted by AGCGA-rich regulatory DNA regions." Nat Commun, 8, 15355. doi: 10.1038/ncomms15355. Structure of DNA tetrameric agcga-quadruplex adopted by 15-mer d(gcgagggagcgaggg), vk34, oligonucleotide found in regulatory region of the plekhg3 human gene . 2 G-tetrads
5mbr DNA NMR Dickerhoff J, Haase L, Langel W, Weisz K (2017) "Tracing Effects of Fluorine Substitutions on G-Quadruplex Conformational Changes." ACS Chem. Biol., 12, 1308-1315. doi: 10.1021/acschembio.6b01096. Quadruplex with flipped tetrad formed by a human telomeric sequence . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUDU, hybrid1, 3+1, 3(-P-Lw-Ln)
5mcr DNA NMR Dickerhoff J, Haase L, Langel W, Weisz K (2017) "Tracing Effects of Fluorine Substitutions on G-Quadruplex Conformational Changes." ACS Chem. Biol., 12, 1308-1315. doi: 10.1021/acschembio.6b01096. Quadruplex with flipped tetrad formed by an artificial sequence . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUD, hybrid2, 3+1, 3(-PD+Lw)
5mjx DNA NMR Lietard J, Abou Assi H, Gomez-Pinto I, Gonzalez C, Somoza MM, Damha MJ (2017) "Mapping the affinity landscape of Thrombin-binding aptamers on 2 F-ANA/DNA chimeric G-Quadruplex microarrays." Nucleic Acids Res., 45, 1619-1632. doi: 10.1093/nar/gkw1357. 2'f-ana-DNA chimeric tba quadruplex structure . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
5mta DNA NMR Juribasic Kulcsar M, Gabelica V, Plavec J (2024) "Solution-State Structure of a Long-Loop G-Quadruplex Formed Within Promoters of Plasmodium falciparum B var Genes." Chemistry, 30, e202401190. doi: 10.1002/chem.202401190. G-quadruplex formed within promoters of plasmodium falciparum b var genes . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUD, hybrid2, 3+1, 3(-PD+Lw)
5mtg DNA NMR Juribasic Kulcsar M, Gabelica V, Plavec J (2024) "Solution-State Structure of a Long-Loop G-Quadruplex Formed Within Promoters of Plasmodium falciparum B var Genes." Chemistry, 30, e202401190. doi: 10.1002/chem.202401190. G-quadruplex formed within promoters of plasmodium falciparum b var genes - form i . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUD, hybrid2, 3+1, 3(-PD+Lw)
5mvb DNA NMR Wirmer-Bartoschek J, Bendel LE, Jonker HRA, Grun JT, Papi F, Bazzicalupi C, Messori L, Gratteri P, Schwalbe H (2017) "Solution NMR Structure of a Ligand/Hybrid-2-G-Quadruplex Complex Reveals Rearrangements that Affect Ligand Binding." Angew. Chem. Int. Ed. Engl., 56, 7102-7106. doi: 10.1002/anie.201702135. Solution structure of a human g-quadruplex hybrid-2 form in complex with a gold-ligand. . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UDUU, hybrid3, 3+1, 3(-Lw-Ln-P)
5nys DNA NMR Trajkovski M, Endoh T, Tateishi-Karimata H, Ohyama T, Tanaka S, Plavec J, Sugimoto N (2018) "Pursuing origins of (poly)ethylene glycol-induced G-quadruplex structural modulations." Nucleic Acids Res., 46, 4301-4315. doi: 10.1093/nar/gky250. M2 g-quadruplex dilute solution . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
5nyt DNA NMR Trajkovski M, Endoh T, Tateishi-Karimata H, Ohyama T, Tanaka S, Plavec J, Sugimoto N (2018) "Pursuing origins of (poly)ethylene glycol-induced G-quadruplex structural modulations." Nucleic Acids Res., 46, 4301-4315. doi: 10.1093/nar/gky250. M2 g-quadruplex 20 wt% ethylene glycol . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
5nyu DNA NMR Trajkovski M, Endoh T, Tateishi-Karimata H, Ohyama T, Tanaka S, Plavec J, Sugimoto N (2018) "Pursuing origins of (poly)ethylene glycol-induced G-quadruplex structural modulations." Nucleic Acids Res., 46, 4301-4315. doi: 10.1093/nar/gky250. M2 g-quadruplex 10 wt% peg8000 . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
5o4d DNA NMR Marusic M, Plavec J (2019) "Towards Understanding of Polymorphism of the G-rich Region of Human Papillomavirus Type 52." Molecules, 24. doi: 10.3390/molecules24071294. G-quadruplex of human papillomavirus type 52 . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UDDD, hybrid4, 1+3, 2(-LwX+P)
5ob3 RNA X-ray (2.004 Å) Fernandez-Millan P, Autour A, Ennifar E, Westhof E, Ryckelynck M (2017) "Crystal structure and fluorescence properties of the iSpinach aptamer in complex with DFHBI." RNA, 23, 1788-1795. doi: 10.1261/rna.063008.117. Ispinach aptamer . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UUDD, anti-parallel:basket2, 2+2, 2(-PD+P)
5oph DNA NMR Brcic J, Plavec J (2018) "NMR structure of a G-quadruplex formed by four d(G4C2) repeats: insights into structural polymorphism." Nucleic Acids Res., 46, 11605-11617. doi: 10.1093/nar/gky886. G-quadruplex structure of DNA oligonucleotide containing ggggcc repeats linked to als and ftd . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UDUD, anti-parallel:chair, 2+2, 4(-Lw-Ln-Lw)
5ov2 DNA NMR Dickerhoff J, Weisz K (2017) "Nonconventional C-HF Hydrogen Bonds Support a Tetrad Flip in Modified G-Quadruplexes." J Phys Chem Lett, 8, 5148-5152. doi: 10.1021/acs.jpclett.7b02428. 2'f-ana-g modified quadruplex with a flipped tetrad . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUD, hybrid2, 3+1, 3(-PD+Lw)
5ua3 DNA X-ray (1.88 Å) Meier M, Moya-Torres A, Krahn NJ, McDougall MD, Orriss GL, McRae EKS, Booy EP, McEleney K, Patel TR, McKenna SA, Stetefeld J (2018) "Structure and hydrodynamics of a DNA G-quadruplex with a cytosine bulge." Nucleic Acids Res., 46, 5319-5331. doi: 10.1093/nar/gky307. Crystal structure of a DNA g-quadruplex with a cytosine bulge . 6 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, UUUU, parallel, 4+0, 3(-P-P-P), coaxial interfaces: 5'/5'
5v3f RNA X-ray (1.7 Å) Trachman RJ, Demeshkina NA, Lau MWL, Panchapakesan SSS, Jeng SCY, Unrau PJ, Ferre-D'Amare AR (2017) "Structural basis for high-affinity fluorophore binding and activation by RNA Mango." Nat. Chem. Biol., 13, 807-813. doi: 10.1038/nchembio.2392. Co-crystal structure of the fluorogenic RNA mango . 6 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, UUUU, parallel, 4+0, 3(-P-P-P), coaxial interfaces: 5'/5'
5vhe hydrolase X-ray (3.793 Å) Chen MC, Tippana R, Demeshkina NA, Murat P, Balasubramanian S, Myong S, Ferre-D'Amare AR (2018) "Structural basis of G-quadruplex unfolding by the DEAH/RHA helicase DHX36." Nature, 558, 465-469. doi: 10.1038/s41586-018-0209-9. Dhx36 in complex with the c-myc g-quadruplex . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 2(-P-P-P)
5w77 DNA-inhibitor NMR Calabrese DR, Chen X, Leon EC, Gaikwad SM, Phyo Z, Hewitt WM, Alden S, Hilimire TA, He F, Michalowski AM, Simmons JK, Saunders LB, Zhang S, Connors D, Walters KJ, Mock BA, Schneekloth Jr JS (2018) "Chemical and structural studies provide a mechanistic basis for recognition of the MYC G-quadruplex." Nat Commun, 9, 4229. doi: 10.1038/s41467-018-06315-w. Solution structure of the myc g-quadruplex bound to small molecule dc-34 . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
5yey DNA NMR Liu C, Zhou B, Geng Y, Yan Tam D, Feng R, Miao H, Xu N, Shi X, You Y, Hong Y, Tang BZ, Kwan Lo P, Kuryavyi V, Zhu G (2019) "A chair-type G-quadruplex structure formed by a human telomeric variant DNA in K+solution." Chem Sci, 10, 218-226. doi: 10.1039/c8sc03813a. The structure of a chair-type g-quadruplex of the human telomeric variant in k+ solution . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UDUD, anti-parallel:chair, 2+2, 3(+Ln+Lw+Ln)
5z80 DNA NMR Liu W, Zhong YF, Liu LY, Shen CT, Zeng W, Wang F, Yang D, Mao ZW (2018) "Solution structures of multiple G-quadruplex complexes induced by a platinum(II)-based tripod reveal dynamic binding." Nat Commun, 9, 3496. doi: 10.1038/s41467-018-05810-4. Solution structure for the 1:1 complex of a platinum(ii)-based tripod bound to a hybrid-1 human telomeric g-quadruplex . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUDU, hybrid1, 3+1, 3(-P-Lw-Ln)
5z8f DNA NMR Liu W, Zhong YF, Liu LY, Shen CT, Zeng W, Wang F, Yang D, Mao ZW (2018) "Solution structures of multiple G-quadruplex complexes induced by a platinum(II)-based tripod reveal dynamic binding." Nat Commun, 9, 3496. doi: 10.1038/s41467-018-05810-4. Solution structure for the unique dimeric 4:2 complex of a platinum(ii)-based tripod bound to a hybrid-1 human telomeric g-quadruplex . 6 G-tetrads, 2 G4 helices, 2 G4 stems, UUDU, hybrid1, 3+1, 3(-P-Lw-Ln)
5zev DNA NMR Liu Y, Lan W, Wang C, Cao C (2018) "A putative G-quadruplex structure in the proximal promoter ofVEGFR-2has implications for drug design to inhibit tumor angiogenesis." J. Biol. Chem., 293, 8947-8955. doi: 10.1074/jbc.RA118.002666. Solution structure of g-quadruplex formed in vegfr-2 proximal promoter sequence . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UDDD, hybrid4, 1+3, 2(D+PX)
6a7y DNA NMR Wan C, Fu W, Jing H, Zhang N (2019) "NMR solution structure of an asymmetric intermolecular leaped V-shape G-quadruplex: selective recognition of the d(G2NG3NG4) sequence motif by a short linear G-rich DNA probe." Nucleic Acids Res., 47, 1544-1556. doi: 10.1093/nar/gky1167. Solution structure of an intermolecular leaped v-shape g-quadruplex . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UDDD, hybrid4, 1+3
6a85 DNA X-ray (1.45 Å) Liu HH, Wang R, Yu X, Shen FS, Lan WX, Haruehanroengra P, Yao QQ, Zhang J, Chen YQ, Li SH, Wu BX, Zheng LN, Ma JB, Lin JZ, Cao CY, Li JX, Sheng J, Gan JH (2018) "High-resolution DNA quadruplex structure containing all the A-, G-, C-, T-tetrads." Nucleic Acids Res., 46, 11627-11638. doi: 10.1093/nar/gky902. Crystal structure of a novel DNA quadruplex . 8 G-tetrads, 2 G4 helices, 2 G4 stems, UUUU, parallel, 4+0
6ac7 DNA NMR Sengar A, Vandana JJ, Chambers VS, Di Antonio M, Winnerdy FR, Balasubramanian S, Phan AT (2019) "Structure of a (3+1) hybrid G-quadruplex in the PARP1 promoter." Nucleic Acids Res., 47, 1564-1572. doi: 10.1093/nar/gky1179. Structure of a (3+1) hybrid g-quadruplex in the parp1 promoter . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UDUU, hybrid3, 3+1, 3(-Lw-Ln-P)
6au4 DNA X-ray (2.35 Å) Stump S, Mou TC, Sprang SR, Natale NR, Beall HD (2018) "Crystal structure of the major quadruplex formed in the promoter region of the human c-MYC oncogene." PLoS ONE, 13, e0205584. doi: 10.1371/journal.pone.0205584. Crystal structure of the major quadruplex formed in the human c-myc promoter . 6 G-tetrads, 2 G4 helices, 2 G4 stems, UUUU, parallel, 4+0, 3(-P-P-P)
6b14 immune system-RNA X-ray (1.64 Å) Koirala D, Shelke SA, Dupont M, Ruiz S, DasGupta S, Bailey LJ, Benner SA, Piccirilli JA (2018) "Affinity maturation of a portable Fab-RNA module for chaperone-assisted RNA crystallography." Nucleic Acids Res., 46, 2624-2635. doi: 10.1093/nar/gkx1292. Crystal structure of spinach RNA aptamer in complex with fab bl3-6s97n . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UUDD, anti-parallel:basket2, 2+2, 2(-PD+P)
6b3k immune system-RNA X-ray (2.09 Å) Koirala D, Shelke SA, Dupont M, Ruiz S, DasGupta S, Bailey LJ, Benner SA, Piccirilli JA (2018) "Affinity maturation of a portable Fab-RNA module for chaperone-assisted RNA crystallography." Nucleic Acids Res., 46, 2624-2635. doi: 10.1093/nar/gkx1292. Crystal structure of mutant spinach RNA aptamer in complex with fab bl3-6 . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UUDD, anti-parallel:basket2, 2+2, 2(-PD+P)
6c63 RNA X-ray (2.9 Å) Trachman 3rd RJ, Abdolahzadeh A, Andreoni A, Cojocaru R, Knutson JR, Ryckelynck M, Unrau PJ, Ferre-D'Amare AR (2018) "Crystal Structures of the Mango-II RNA Aptamer Reveal Heterogeneous Fluorophore Binding and Guide Engineering of Variants with Improved Selectivity and Brightness." Biochemistry, 57, 3544-3548. doi: 10.1021/acs.biochem.8b00399. Crystal structure of the mango-ii fluorescent aptamer bound to to1-biotin . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
6c64 RNA X-ray (3.0 Å) Trachman 3rd RJ, Abdolahzadeh A, Andreoni A, Cojocaru R, Knutson JR, Ryckelynck M, Unrau PJ, Ferre-D'Amare AR (2018) "Crystal Structures of the Mango-II RNA Aptamer Reveal Heterogeneous Fluorophore Binding and Guide Engineering of Variants with Improved Selectivity and Brightness." Biochemistry, 57, 3544-3548. doi: 10.1021/acs.biochem.8b00399. Crystal structure of the mango-ii fluorescent aptamer bound to to3-biotin . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
6c65 RNA X-ray (2.8 Å) Trachman 3rd RJ, Abdolahzadeh A, Andreoni A, Cojocaru R, Knutson JR, Ryckelynck M, Unrau PJ, Ferre-D'Amare AR (2018) "Crystal Structures of the Mango-II RNA Aptamer Reveal Heterogeneous Fluorophore Binding and Guide Engineering of Variants with Improved Selectivity and Brightness." Biochemistry, 57, 3544-3548. doi: 10.1021/acs.biochem.8b00399. Crystal structure of the mango-ii-a22u fluorescent aptamer bound to to1-biotin . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
6ccw DNA NMR Lin C, Wu G, Wang K, Onel B, Sakai S, Shao Y, Yang D (2018) "Molecular Recognition of the Hybrid-2 Human Telomeric G-Quadruplex by Epiberberine: Insights into Conversion of Telomeric G-Quadruplex Structures." Angew. Chem. Int. Ed. Engl., 57, 10888-10893. doi: 10.1002/anie.201804667. Hybrid-2 form human telomeric g quadruplex in complex with epiberberine . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UDUU, hybrid3, 3+1, 3(-Lw-Ln-P)
6e80 RNA X-ray (2.901 Å) Sjekloca L, Ferre-D'Amare AR (2019) "Binding between G Quadruplexes at the Homodimer Interface of the Corn RNA Aptamer Strongly Activates Thioflavin T Fluorescence." Cell Chem Biol, 26, 1159. doi: 10.1016/j.chembiol.2019.04.012. Crystal structure of the corn aptamer in unliganded state . 4 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, UUUU, parallel, 4+0, 2(-P-P-P), coaxial interfaces: 5'/5'
6e81 RNA X-ray (2.721 Å) Sjekloca L, Ferre-D'Amare AR (2019) "Binding between G Quadruplexes at the Homodimer Interface of the Corn RNA Aptamer Strongly Activates Thioflavin T Fluorescence." Cell Chem Biol, 26, 1159. doi: 10.1016/j.chembiol.2019.04.012. Crystal structure of the corn aptamer in complex with tht . 4 G-tetrads, 2 G4 helices, 2 G4 stems, UUUU, parallel, 4+0, 2(-P-P-P)
6e82 RNA X-ray (3.101 Å) Sjekloca L, Ferre-D'Amare AR (2019) "Binding between G Quadruplexes at the Homodimer Interface of the Corn RNA Aptamer Strongly Activates Thioflavin T Fluorescence." Cell Chem Biol, 26, 1159. doi: 10.1016/j.chembiol.2019.04.012. Crystal structure of the corn aptamer mutant a14u in complex with tht . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 2(-P-P-P)
6e84 RNA X-ray (2.901 Å) Sjekloca L, Ferre-D'Amare AR (2019) "Binding between G Quadruplexes at the Homodimer Interface of the Corn RNA Aptamer Strongly Activates Thioflavin T Fluorescence." Cell Chem Biol, 26, 1159. doi: 10.1016/j.chembiol.2019.04.012. Crystal structure of the corn aptamer in complex with to . 4 G-tetrads, 2 G4 helices, 2 G4 stems, UUUU, parallel, 4+0, 2(-P-P-P)
6e8s RNA X-ray (2.35 Å) Trachman 3rd RJ, Autour A, Jeng SCY, Abdolahzadeh A, Andreoni A, Cojocaru R, Garipov R, Dolgosheina EV, Knutson JR, Ryckelynck M, Unrau PJ, Ferre-D'Amare AR (2019) "Structure and functional reselection of the Mango-III fluorogenic RNA aptamer." Nat. Chem. Biol., 15, 472-479. doi: 10.1038/s41589-019-0267-9. Structure of the imango-iii aptamer bound to to1-biotin . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UUUD, hybrid2, 3+1, 2(-P-P-Lw)
6e8t RNA X-ray (2.9 Å) Trachman 3rd RJ, Autour A, Jeng SCY, Abdolahzadeh A, Andreoni A, Cojocaru R, Garipov R, Dolgosheina EV, Knutson JR, Ryckelynck M, Unrau PJ, Ferre-D'Amare AR (2019) "Structure and functional reselection of the Mango-III fluorogenic RNA aptamer." Nat. Chem. Biol., 15, 472-479. doi: 10.1038/s41589-019-0267-9. Structure of the mango-iii (a10u) aptamer bound to to1-biotin . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UUUD, hybrid2, 3+1, 2(-P-Lw)
6e8u RNA X-ray (1.55 Å) Trachman 3rd RJ, Autour A, Jeng SCY, Abdolahzadeh A, Andreoni A, Cojocaru R, Garipov R, Dolgosheina EV, Knutson JR, Ryckelynck M, Unrau PJ, Ferre-D'Amare AR (2019) "Structure and functional reselection of the Mango-III fluorogenic RNA aptamer." Nat. Chem. Biol., 15, 472-479. doi: 10.1038/s41589-019-0267-9. Structure of the mango-iii (a10u) aptamer bound to to1-biotin . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UUUD, hybrid2, 3+1, 2(-P-P-Lw)
6eo6 hydrolase-DNA X-ray (1.69 Å) Dolot R, Lam CH, Sierant M, Zhao Q, Liu FW, Nawrot B, Egli M, Yang X (2018) "Crystal structures of thrombin in complex with chemically modified thrombin DNA aptamers reveal the origins of enhanced affinity." Nucleic Acids Res., 46, 4819-4830. doi: 10.1093/nar/gky268. X-ray structure of the complex between human alpha-thrombin and modified 15-mer DNA aptamer containing 5-(3-(2-(1h-indol-3-yl)acetamide-n-yl)-1-propen-1-yl)-2'-deoxyuridine residue . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
6eo7 hydrolase-DNA X-ray (2.24 Å) Dolot R, Lam CH, Sierant M, Zhao Q, Liu FW, Nawrot B, Egli M, Yang X (2018) "Crystal structures of thrombin in complex with chemically modified thrombin DNA aptamers reveal the origins of enhanced affinity." Nucleic Acids Res., 46, 4819-4830. doi: 10.1093/nar/gky268. X-ray structure of the complex between human alpha-thrombin and modified 15-mer DNA aptamer containing 5-(3-(acetamide-n-yl)-1-propen-1-yl)-2'-deoxyuridine residue . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
6erl DNA NMR Karg B, Weisz K (2018) "Loop Length Affects Syn-Anti Conformational Rearrangements in Parallel G-Quadruplexes." Chemistry. doi: 10.1002/chem.201801851. Quadruplex with flipped tetrad formed by the c-myc promoter sequence . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
6evv hydrolase X-ray (2.5 Å) Troisi R, Napolitano V, Spiridonova V, Russo Krauss I, Sica F (2018) "Several structural motifs cooperate in determining the highly effective anti-thrombin activity of NU172 aptamer." Nucleic Acids Res., 46, 12177-12185. doi: 10.1093/nar/gky990. X-ray structure of the complex between human alpha thrombin and nu172, a duplex-quadruplex 26-mer DNA aptamer, in the presence of potassium ions. . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
6f4z DNA NMR Dickerhoff J, Weisz K (2018) "Fluorine-Mediated Editing of a G-Quadruplex Folding Pathway." Chembiochem, 19, 927-930. doi: 10.1002/cbic.201800099. 2'f-arag modified quadruplex with flipped g-tract and central tetrad . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUDD, anti-parallel:basket2, 2+2, 3(+LnD-Lw)
6fc9 DNA NMR Diaz-Casado L, Serrano-Chacon I, Montalvillo-Jimenez L, Corzana F, Bastida A, Santana AG, Gonzalez C, Asensio JL (2020) "De Novo Design of Selective Quadruplex-Duplex Junction Ligands and Structural Characterisation of Their Binding Mode: Targeting the G4 Hot-Spot." Chemistry. doi: 10.1002/chem.202005026. The 1,8-bis(aminomethyl)anthracene and quadruplex-duplex junction complex . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
6ffr DNA-RNA hybrid NMR Haase L, Dickerhoff J, Weisz K (2018) "DNA-RNA Hybrid Quadruplexes Reveal Interactions that Favor RNA Parallel Topologies." Chemistry, 24, 15365-15371. doi: 10.1002/chem.201803367. DNA-RNA hybrid quadruplex with flipped tetrad . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUD, hybrid2, 3+1, 3(-PD+Lw)
6fq2 DNA X-ray (2.31 Å) Bakalar B, Heddi B, Schmitt E, Mechulam Y, Phan AT (2019) "A Minimal Sequence for Left-Handed G-Quadruplex Formation." Angew. Chem. Int. Ed. Engl., 58, 2331-2335. doi: 10.1002/anie.201812628. Structure of minimal sequence for left -handed g-quadruplex formation . 4 G-tetrads, 1 G4 helix
6ftu DNA X-ray (2.95 Å) Guedin A, Lin LY, Armane S, Lacroix L, Mergny JL, Thore S, Yatsunyk LA (2018) "Quadruplexes in 'Dicty': crystal structure of a four-quartet G-quadruplex formed by G-rich motif found in the Dictyostelium discoideum genome." Nucleic Acids Res., 46, 5297-5307. doi: 10.1093/nar/gky290. Structure of a quadruplex forming sequence from d. discoideum . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UUDD, anti-parallel:basket2, 2+2, 4(+LnD-Lw)
6ge1 RNA NMR Andralojc W, Malgowska M, Sarzynska J, Pasternak K, Szpotkowski K, Kierzek R, Gdaniec Z (2019) "Unraveling the structural basis for the exceptional stability of RNA G-quadruplexes capped by a uridine tetrad at the 3' terminus." RNA, 25, 121-134. doi: 10.1261/rna.068163.118. Solution structure of the r(ugguggu)4 RNA quadruplex . 4 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, UUUU, parallel, 4+0, coaxial interfaces: 3'/5'
6gh0 DNA NMR Kotar A, Rigo R, Sissi C, Plavec J (2019) "Two-quartet kit* G-quadruplex is formed via double-stranded pre-folded structure." Nucleic Acids Res., 47, 2641-2653. doi: 10.1093/nar/gky1269. Two-quartet kit* g-quadruplex is formed via double-stranded pre-folded structure . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UDUD, anti-parallel:chair, 2+2, 2(-Lw-Ln-Lw)
6gn7 hydrolase X-ray (2.8 Å) Troisi R, Napolitano V, Spiridonova V, Russo Krauss I, Sica F (2018) "Several structural motifs cooperate in determining the highly effective anti-thrombin activity of NU172 aptamer." Nucleic Acids Res., 46, 12177-12185. doi: 10.1093/nar/gky990. X-ray structure of the complex between human alpha thrombin and nu172, a duplex-quadruplex 26-mer DNA aptamer, in the presence of sodium ions. . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
6gz6 DNA X-ray (2.006 Å) Bakalar B, Heddi B, Schmitt E, Mechulam Y, Phan AT (2019) "A Minimal Sequence for Left-Handed G-Quadruplex Formation." Angew.Chem.Int.Ed.Engl., 58, 2331-2335. doi: 10.1002/anie.201812628. Structure of a left-handed g-quadruplex . 4 G-tetrads, 1 G4 helix
6gzn DNA NMR Lenarcic Zivkovic M, Rozman J, Plavec J (2018) "Adenine-Driven Structural Switch from a Two- to Three-Quartet DNA G-Quadruplex." Angew. Chem. Int. Ed. Engl., 57, 15395-15399. doi: 10.1002/anie.201809328. Adenine-driven structural switch from two- to three-quartet DNA g-quadruplex . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UDDU, anti-parallel:basket, 2+2, 2(-LwD+Ln)
6h1k DNA NMR Butovskaya E, Heddi B, Bakalar B, Richter SN, Phan AT (2018) "Major G-Quadruplex Form of HIV-1 LTR Reveals a (3 + 1) Folding Topology Containing a Stem-Loop." J. Am. Chem. Soc., 140, 13654-13662. doi: 10.1021/jacs.8b05332. The major g-quadruplex form of hiv-1 ltr . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UDDD, hybrid4, 1+3, 2(D+PX)
6h5r DNA X-ray (2.0 Å) Guarra F, Marzo T, Ferraroni M, Papi F, Bazzicalupi C, Gratteri P, Pescitelli G, Messori L, Biver T, Gabbiani C (2018) "Interaction of a gold(i) dicarbene anticancer drug with human telomeric DNA G-quadruplex: solution and computationally aided X-ray diffraction analysis." Dalton Trans, 47, 16132-16138. doi: 10.1039/c8dt03607a. Structure of the complex of a human telomeric DNA with bis(1-butyl-3-methyl-imidazole-2-ylidene) gold(i) . 6 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, UUUU, parallel, 4+0, 3(-P-P-P), coaxial interfaces: 5'/5'
6ia0 DNA NMR Bielskute S, Plavec J, Podbevsek P (2019) "Impact of Oxidative Lesions on the Human Telomeric G-Quadruplex." J. Am. Chem. Soc., 141, 2594-2603. doi: 10.1021/jacs.8b12748. Human telomeric g-quadruplex with 8-oxo-g substitution in the central g-quartet . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UDUU, hybrid3, 3+1, 3(-Lw-Ln-P)
6ia4 DNA NMR Bielskute S, Plavec J, Podbevsek P (2019) "Impact of Oxidative Lesions on the Human Telomeric G-Quadruplex." J. Am. Chem. Soc., 141, 2594-2603. doi: 10.1021/jacs.8b12748. Human telomeric g-quadruplex with 8-oxo-g substitution in the outer g-quartet . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUDU, hybrid1, 3+1, 3(-P-Lw-Ln)
6ip3 DNA X-ray (1.4 Å) Nuthanakanti A, Ahmed I, Khatik SY, Saikrishnan K, Srivatsan SG (2019) "Probing G-quadruplex topologies and recognition concurrently in real time and 3D using a dual-app nucleoside probe." Nucleic Acids Res., 47, 6059-6072. doi: 10.1093/nar/gkz419. Structure of human telomeric DNA at 1.4 angstroms resolution . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
6ip7 DNA X-ray (1.55 Å) Nuthanakanti A, Ahmed I, Khatik SY, Saikrishnan K, Srivatsan SG (2019) "Probing G-quadruplex topologies and recognition concurrently in real time and 3D using a dual-app nucleoside probe." Nucleic Acids Res., 47, 6059-6072. doi: 10.1093/nar/gkz419. Structure of human telomeric DNA with 5-selenophene-modified deoxyuridine at residue 11 . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P)
6isw DNA X-ray (2.3 Å) Nuthanakanti A, Ahmed I, Khatik SY, Saikrishnan K, Srivatsan SG (2019) "Probing G-quadruplex topologies and recognition concurrently in real time and 3D using a dual-app nucleoside probe." Nucleic Acids Res., 47, 6059-6072. doi: 10.1093/nar/gkz419. Structure of human telomeric DNA with 5-selenophene-modified deoxyuridine at residue 12 . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P)
6jcd DNA NMR Truong THA, Winnerdy FR, Phan AT (2019) "An Unprecedented Knot-like G-Quadruplex Peripheral Motif." Angew.Chem.Int.Ed.Engl., 58, 13834-13839. doi: 10.1002/anie.201907740. G-quadruplex peripheral knot . 2 G-tetrads, 1 G4 helix
6jce DNA NMR Winnerdy FR, Bakalar B, Maity A, Vandana JJ, Mechulam Y, Schmitt E, Phan AT (2019) "NMR solution and X-ray crystal structures of a DNA molecule containing both right- and left-handed parallel-stranded G-quadruplexes." Nucleic Acids Res., 47, 8272-8281. doi: 10.1093/nar/gkz349. NMR solution and x-ray crystal structures of a DNA containing both right-and left-handed parallel-stranded g-quadruplexes . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 2(-P-P-P)
6jj0 DNA NMR Liu W, Lin C, Wu G, Dai J, Chang TC, Yang D (2019) "Structures of 1:1 and 2:1 complexes of BMVC and MYC promoter G-quadruplex reveal a mechanism of ligand conformation adjustment for G4-recognition." Nucleic Acids Res., 47, 11931-11942. doi: 10.1093/nar/gkz1015. NMR structure of the 1:1 complex of a carbazole derivative bmvc bound to c-myc g-quadruplex . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
6jje DNA X-ray (1.378 Å) Zhang YS, Parkinson GN, Wagner A, Wei DG "Crystal structure of a two-quartet DNA mixed-parallel/antiparallel G-quadruplex (BrU)." Crystal structure of a two-quartet DNA mixed-parallel-antiparallel g-quadruplex (bru) . 4 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, UDUD, anti-parallel:chair, 2+2; UUUU, parallel, 4+0, coaxial interfaces: mixed
6jjf DNA X-ray (1.47 Å) Zhang Y, El Omari K, Duman R, Liu S, Haider S, Wagner A, Parkinson GN, Wei D (2020) "Native de novo structural determinations of non-canonical nucleic acid motifs by X-ray crystallography at long wavelengths." Nucleic Acids Res., 48, 9886-9898. doi: 10.1093/nar/gkaa439. Crystal structure of a two-quartet DNA mixed-parallel-antiparallel g-quadruplex . 4 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, UDUD, anti-parallel:chair, 2+2; UUUU, parallel, 4+0, coaxial interfaces: mixed
6jjg DNA X-ray (1.969 Å) Zhang YS, Parkinson GN, Wagner A, Wei DG "Crystal structure of a two-quartet DNA mixed-parallel/antiparallel G-quadruplex." Crystal structure of a two-quartet DNA mixed-parallel-antiparallel g-quadruplex . 4 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, UDUD, anti-parallel:chair, 2+2; UUUU, parallel, 4+0, coaxial interfaces: mixed
6jjh RNA X-ray (1.74 Å) Zhang Y, El Omari K, Duman R, Liu S, Haider S, Wagner A, Parkinson GN, Wei D (2020) "Native de novo structural determinations of non-canonical nucleic acid motifs by X-ray crystallography at long wavelengths." Nucleic Acids Res., 48, 9886-9898. doi: 10.1093/nar/gkaa439. Crystal structure of a two-quartet RNA parallel g-quadruplex complexed with the porphyrin tmpyp4 . 4 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, UUUU, parallel, 4+0, coaxial interfaces: 3'/5'
6jji RNA X-ray (3.1 Å) Zhang Y, El Omari K, Duman R, Liu S, Haider S, Wagner A, Parkinson GN, Wei D (2020) "Native de novo structural determinations of non-canonical nucleic acid motifs by X-ray crystallography at long wavelengths." Nucleic Acids Res., 48, 9886-9898. doi: 10.1093/nar/gkaa439. Crystal structure of a two-quartet RNA parallel g-quadruplex complexed with the porphyrin tmpyp4 (1:1) . 4 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, UUUU, parallel, 4+0, coaxial interfaces: 3'/5'
6jkn DNA X-ray (1.401 Å) Geng Y, Liu C, Zhou B, Cai Q, Miao H, Shi X, Xu N, You Y, Fung CP, Din RU, Zhu G (2019) "The crystal structure of an antiparallel chair-type G-quadruplex formed by Bromo-substituted human telomeric DNA." Nucleic Acids Res., 47, 5395-5404. doi: 10.1093/nar/gkz221. Crystal structure of g-quadruplex formed by bromo-substituted human telomeric DNA . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UDUD, anti-parallel:chair, 2+2, 3(-Lw-Ln-Lw)
6jwd DNA NMR Wang F, Wang C, Liu Y, Lan W, Han H, Wang R, Huang S, Cao C (2020) "Colchicine selective interaction with oncogene RET G-quadruplex revealed by NMR." Chem.Commun.(Camb.), 56, 2099-2102. doi: 10.1039/d0cc00221f. Structure of ret g-quadruplex in complex with berberine . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
6jwe DNA NMR Wang F, Wang C, Liu Y, Lan W, Han H, Wang R, Huang S, Cao C (2020) "Colchicine selective interaction with oncogene RET G-quadruplex revealed by NMR." Chem.Commun.(Camb.), 56, 2099-2102. doi: 10.1039/d0cc00221f. Structure of ret g-quadruplex in complex with colchicine . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
6k3x DNA NMR Winnerdy FR, Das P, Heddi B, Phan AT (2019) "Solution Structures of a G-Quadruplex Bound to Linear- and Cyclic-Dinucleotides." J.Am.Chem.Soc., 141, 18038-18047. doi: 10.1021/jacs.9b05642. G-quadruplex complex with linear dinucleotide d(ag) . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 2(-P-P-P)
6k3y DNA NMR Winnerdy FR, Das P, Heddi B, Phan AT (2019) "Solution Structures of a G-Quadruplex Bound to Linear- and Cyclic-Dinucleotides." J.Am.Chem.Soc., 141, 18038-18047. doi: 10.1021/jacs.9b05642. G-quadruplex complex with cyclic dinucleotide 3'-3' cgamp . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 2(-P-P-P)
6k84 RNA NMR Mashima T, Lee JH, Kamatari YO, Hayashi T, Nagata T, Nishikawa F, Nishikawa S, Kinoshita M, Kuwata K, Katahira M (2020) "Development and structural determination of an anti-PrPCaptamer that blocks pathological conformational conversion of prion protein." Sci Rep, 10, 4934. doi: 10.1038/s41598-020-61966-4. Structure of anti-prion RNA aptamer . 4 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, UUUU, parallel, 4+0, 2(-P-P-P), coaxial interfaces: 5'/5'
6kfi DNA NMR Liu LY, Liu W, Wang KN, Zhu BC, Xia XY, Ji LN, Mao ZW (2020) "Quantitative Detection of G-Quadruplex DNA in Live Cells Based on Photon Counts and Complex Structure Discrimination." Angew.Chem.Int.Ed.Engl., 59, 9719-9726. doi: 10.1002/anie.202002422. NMR solution structure of the 1:1 complex of tel26 g-quadruplex and a tripodal cationic fluorescent probe nbte . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUDU, hybrid1, 3+1, 3(-P-Lw-Ln)
6kfj DNA NMR Liu LY, Liu W, Wang KN, Zhu BC, Xia XY, Ji LN, Mao ZW (2020) "Quantitative Detection of G-Quadruplex DNA in Live Cells Based on Photon Counts and Complex Structure Discrimination." Angew.Chem.Int.Ed.Engl., 59, 9719-9726. doi: 10.1002/anie.202002422. NMR solution structure of the 1:1 complex of wttel26 g-quadruplex and a tripodal cationic fluorescent probe nbte . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UDUU, hybrid3, 3+1, 3(-Lw-Ln-P)
6kfl DNA X-ray (1.92 Å) Zhang YS, Parkinson GN, Wei DG "Crystal structure of a two-quartet DNA G-quadruplex complexed with the porphyrin TMPyP4." Crystal structure of a two-quartet DNA g-quadruplex complexed with the porphyrin tmpyp4 . 4 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, UDUD, anti-parallel:chair, 2+2; UUUU, parallel, 4+0, coaxial interfaces: mixed
6kn4 DNA NMR Barthwal R, Raje S, Pandav K (2021) "Structural basis for stabilization of human telomeric G-quadruplex [d-(TTAGGGT)] 4 by anticancer drug adriamycin." J.Biomol.Struct.Dyn., 39, 795-815. doi: 10.1080/07391102.2020.1730969. Human parallel stranded 7-mer g-quadruplex complexed with 2 adriamycin (dm2) molecules . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0
6kvb DNA NMR Maity A, Winnerdy FR, Chang WD, Chen G, Phan AT (2020) "Intra-locked G-quadruplex structures formed by irregular DNA G-rich motifs." Nucleic Acids Res., 48, 3315-3327. doi: 10.1093/nar/gkaa008. Structure of an intra-locked g-quadruplex . 4 G-tetrads, 1 G4 helix
6kxz DNA NMR Barthwal R, Raje S, Pandav K (2020) "Structural basis for stabilization of human telomeric G-quadruplex [d-(TTAGGGT)] 4 by anticancer drug epirubicin." Bioorg.Med.Chem., 28, 115761. doi: 10.1016/j.bmc.2020.115761. Human parallel stranded 7-mer g-quadruplex complexed with 2 epirubicin (epi) molecules . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0
6l8m DNA NMR Wang ZF, Li MH, Chu IT, Winnerdy FR, Phan AT, Chang TC (2020) "Cytosine epigenetic modification modulates the formation of an unprecedented G4 structure in the WNT1 promoter." Nucleic Acids Res., 48, 1120-1130. doi: 10.1093/nar/gkz1207. Wnt DNA promoter mutant g-quadruplex . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UDDD, hybrid4, 1+3, 2(-LwX+P)
6l92 DNA NMR Wang ZF, Li MH, Chu IT, Winnerdy FR, Phan AT, Chang TC (2020) "Cytosine epigenetic modification modulates the formation of an unprecedented G4 structure in the WNT1 promoter." Nucleic Acids Res., 48, 1120-1130. doi: 10.1093/nar/gkz1207. A basket type g-quadruplex in wnt DNA promoter . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUD, hybrid2, 3+1, 3(+LnD-P)
6ldm DNA binding protein-DNA X-ray (2.4 Å) Traczyk A, Liew CW, Gill DJ, Rhodes D (2020) "Structural basis of G-quadruplex DNA recognition by the yeast telomeric protein Rap1." Nucleic Acids Res., 48, 4562-4571. doi: 10.1093/nar/gkaa171. Structural basis of g-quadruplex DNA recognition by the yeast telomeric protein rap1 . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
6lnz DNA NMR Zhu BC, He J, Liu W, Xia XY, Liu LY, Liang BB, Yao HG, Liu B, Ji LN, Mao ZW (2021) "Selectivity and Targeting of G-Quadruplex Binders Activated by Adaptive Binding and Controlled by Chemical Kinetics." Angew.Chem.Int.Ed.Engl., 60, 15340-15343. doi: 10.1002/anie.202104624. NMR solution structure of vegf g-quadruplex bound a non-planar cyclometalated-carbene platinum(ii) complex . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
6m05 DNA NMR Jing H, Fu W, Hu W, Xu S, Xu X, He M, Liu Y, Zhang N (2021) "NMR structural study on the self-trimerization of d(GTTAGG) into a dynamic trimolecular G-quadruplex assembly preferentially in Na+ solution with a moderate K+ tolerance." Nucleic Acids Res., 49, 2306-2316. doi: 10.1093/nar/gkab028. Trimolecular g-quadruplex . 2 G-tetrads, 1 G4 helix
6n65 DNA X-ray (1.6 Å) Ou A, Schmidberger JW, Wilson KA, Evans CW, Hargreaves JA, Grigg M, O'Mara ML, Iyer KS, Bond CS, Smith NM (2020) "High resolution crystal structure of a KRAS promoter G-quadruplex reveals a dimer with extensive poly-A pi-stacking interactions for small-molecule recognition." Nucleic Acids Res., 48, 5766-5776. doi: 10.1093/nar/gkaa262. Kras g-quadruplex g16t mutant. . 6 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, UUUU, parallel, 4+0, 3(-P-P-P), coaxial interfaces: 5'/5'
6neb DNA NMR Dickerhoff J, Onel B, Chen L, Chen Y, Yang D (2019) "Solution Structure of a MYC Promoter G-Quadruplex with 1:6:1 Loop Length." Acs Omega, 4, 2533-2539. doi: 10.1021/acsomega.8b03580. Myc promoter g-quadruplex with 1:6:1 loop length . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
6o2l DNA NMR Liu W, Lin C, Wu G, Dai J, Chang TC, Yang D (2019) "Structures of 1:1 and 2:1 complexes of BMVC and MYC promoter G-quadruplex reveal a mechanism of ligand conformation adjustment for G4-recognition." Nucleic Acids Res., 47, 11931-11942. doi: 10.1093/nar/gkz1015. NMR structure of the 2:1 complex of a carbazole derivative bmvc bound to c-myc g-quadruplex . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
6p45 DNA X-ray (2.339 Å) Lin LY, McCarthy S, Powell BM, Manurung Y, Xiang IM, Dean WL, Chaires B, Yatsunyk LA (2020) "Biophysical and X-ray structural studies of the (GGGTT)3GGG G-quadruplex in complex with N-methyl mesoporphyrin IX." Plos One, 15, e0241513. doi: 10.1371/journal.pone.0241513. Crystal structure of the g-quadruplex formed by (tgggt)4 in complex with n-methylmesoporphryin ix . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
6pnk DNA X-ray (2.39 Å) Lin LY, McCarthy S, Powell BM, Manurung Y, Xiang IM, Dean WL, Chaires B, Yatsunyk LA (2020) "Biophysical and X-ray structural studies of the (GGGTT)3GGG G-quadruplex in complex with N-methyl mesoporphyrin IX." Plos One, 15, e0241513. doi: 10.1371/journal.pone.0241513. Crystal structure of the g-quadruplex formed by (gggtt)3ggg in complex with n-methylmesoporphryin ix . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
6pq7 RNA X-ray (3.0 Å) Trachman III RJ, Stagno JR, Conrad C, Jones CP, Fischer P, Meents A, Wang YX, Ferre-D'Amare AR (2019) "Co-crystal structure of the iMango-III fluorescent RNA aptamer using an X-ray free-electron laser." Acta Crystallogr.,Sect.F, 75, 547-551. doi: 10.1107/S2053230X19010136. Structure of the imango-iii fluorescent aptamer at room temperature. . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UUUD, hybrid2, 3+1, 2(-P-P-Lw)
6q6r DNA binding protein X-ray (1.5 Å) Heddi B, Cheong VV, Schmitt E, Mechulam Y, Phan AT (2020) "Recognition of different base tetrads by RHAU (DHX36): X-ray crystal structure of the G4 recognition motif bound to the 3'-end tetrad of a DNA G-quadruplex." J.Struct.Biol., 209, 107399. doi: 10.1016/j.jsb.2019.10.001. Recognition of different base tetrads by rhau: x-ray crystal structure of g4 recognition motif bound to the 3-end tetrad of a DNA g-quadruplex . 12 G-tetrads, 2 G4 helices, 4 G4 stems, 2 G4 coaxial stacks, UUUU, parallel, 4+0, 3(-P-P-P), coaxial interfaces: 5'/5'
6qjo DNA X-ray (1.8 Å) Winnerdy FR, Bakalar B, Maity A, Vandana JJ, Mechulam Y, Schmitt E, Phan AT (2019) "NMR solution and X-ray crystal structures of a DNA molecule containing both right- and left-handed parallel-stranded G-quadruplexes." Nucleic Acids Res., 47, 8272-8281. doi: 10.1093/nar/gkz349. DNA containing both right- and left-handed parallel-stranded g-quadruplexes . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 2(-P-P-P)
6r9k DNA NMR Karg B, Mohr S, Weisz K (2019) "Duplex-Guided Refolding into Novel G-Quadruplex (3+1) Hybrid Conformations." Angew.Chem.Int.Ed.Engl., 58, 11068-11071. doi: 10.1002/anie.201905372. A quadruplex hybrid structure with lpp loop orientation and 3 syn residues . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UDDD, hybrid4, 1+3, 3(+Ln+P+P)
6r9l DNA NMR Karg B, Mohr S, Weisz K (2019) "Duplex-Guided Refolding into Novel G-Quadruplex (3+1) Hybrid Conformations." Angew.Chem.Int.Ed.Engl., 58, 11068-11071. doi: 10.1002/anie.201905372. A quadruplex hybrid structure with lpp loop orientation and 5 syn residues . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UDDD, hybrid4, 1+3, 3(+Ln+P+P)
6rnl DNA X-ray (1.88 Å) McQuaid K, Hall JP, Baumgaertner L, Cardin DJ, Cardin CJ (2019) "Three thymine/adenine binding modes of the ruthenium complex Lambda-[Ru(TAP)2(dppz)]2+to the G-quadruplex forming sequence d(TAGGGTT) shown by X-ray crystallography." Chem.Commun.(Camb.), 55, 9116-9119. doi: 10.1039/c9cc04316k. L-[ru(tap)2(dppz)]2+ bound to the g-quadruplex forming sequence d(tagggtt) . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0
6rs3 DNA NMR Haase L, Dickerhoff J, Weisz K (2020) "Sugar Puckering Drives G-Quadruplex Refolding: Implications for V-Shaped Loops." Chemistry, 26, 524-533. doi: 10.1002/chem.201904044. 2'-f-riboguanosine modified g-quadruplex with v-loop . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UDDD, hybrid4, 1+3, 2(-LwX+P)
6s15 DNA X-ray (1.7 Å) Papi F, Bazzicalupi C, Ferraroni M, Ciolli G, Lombardi P, Khan AY, Kumar GS, Gratteri P (2020) "Pyridine Derivative of the Natural Alkaloid Berberine as Human Telomeric G4-DNA Binder: A Solution and Solid-State Study." Acs Med.Chem.Lett., 11, 645-650. doi: 10.1021/acsmedchemlett.9b00516. Pyridine derivative of the natural alkaloid berberine as human telomeric g-quadruplex binder . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0
6suu DNA NMR Marquevielle J, Robert C, Lagrabette O, Wahid M, Bourdoncle A, Xodo LE, Mergny JL, Salgado GF (2020) "Structure of two G-quadruplexes in equilibrium in the KRAS promoter." Nucleic Acids Res., 48, 9336-9345. doi: 10.1093/nar/gkaa387. NMR structure of kras32r g9t conformer g-quadruplex within kras promoter region . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 2(-P-P-P)
6sx6 DNA NMR Pavc D, Wang B, Spindler L, Drevensek-Olenik I, Plavec J, Sket P (2020) "GC ends control topology of DNA G-quadruplexes and their cation-dependent assembly." Nucleic Acids Res., 48, 2749-2761. doi: 10.1093/nar/gkaa058. Guanine-rich oligonucleotide with 5'-gc end form g-quadruplex with a(gggg)a hexad, gcgc- and g-quartets and two symmetric gg and aa base pairs . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0
6syk DNA NMR Pavc D, Wang B, Spindler L, Drevensek-Olenik I, Plavec J, Sket P (2020) "GC ends control topology of DNA G-quadruplexes and their cation-dependent assembly." Nucleic Acids Res., 48, 2749-2761. doi: 10.1093/nar/gkaa058. Guanine-rich oligonucleotide with 5'- and 3'-gc ends form g-quadruplex with a(gggg)a hexad, gcgc- and g-quartets and two symmetric gg and aa base pair . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0
6t2g DNA NMR Marquevielle J, Robert C, Lagrabette O, Wahid M, Bourdoncle A, Xodo LE, Mergny JL, Salgado GF (2020) "Structure of two G-quadruplexes in equilibrium in the KRAS promoter." Nucleic Acids Res., 48, 9336-9345. doi: 10.1093/nar/gkaa387. NMR structure of kras32r g25t conformer g-quadruplex within kras promoter region . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
6t51 DNA NMR Marquevielle J, Kumar MVV, Mergny JL, Salgado GF (2018) "1H,13C, and15N chemical shift assignments of a G-quadruplex forming sequence within the KRAS proto-oncogene promoter region." Biomol.Nmr Assign., 12, 123-127. doi: 10.1007/s12104-017-9793-0. NMR structure of kras22rt g-quadruplex forming within kras promoter region at physological temperature . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
6tc8 DNA NMR Haase L, Weisz K (2020) "Switching the type of V-loop in sugar-modified G-quadruplexes through altered fluorine interactions." Chem.Commun.(Camb.), 56, 4539-4542. doi: 10.1039/d0cc01285h. 2'-f-arabinoguanosine and 2'-f-riboguanosine modified hybrid type g-quadruplex with v-loop . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UDDD, hybrid4, 1+3, 2(-LwX+P)
6tcg DNA NMR Haase L, Weisz K (2020) "Switching the type of V-loop in sugar-modified G-quadruplexes through altered fluorine interactions." Chem.Commun.(Camb.), 56, 4539-4542. doi: 10.1039/d0cc01285h. 2'-f-riboguanosine and 2'-f-arabinoguanosine modified g-quadruplex with v-loop and all-syn g-tract . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UDDD, hybrid4, 1+3, 2(-LwX+P)
6tzq DNA X-ray (2.29 Å) Chu B, Zhang D, Paukstelis PJ (2019) "A DNA G-quadruplex/i-motif hybrid." Nucleic Acids Res., 47, 11921-11930. doi: 10.1093/nar/gkz1008. A DNA g-quadruplex-i-motif hybrid . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UDUD, anti-parallel:chair, 2+2
6tzr DNA X-ray (2.4 Å) Chu B, Zhang D, Paukstelis PJ (2019) "A DNA G-quadruplex/i-motif hybrid." Nucleic Acids Res., 47, 11921-11930. doi: 10.1093/nar/gkz1008. A DNA g-quadruplex-i-motif hybrid . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UDUD, anti-parallel:chair, 2+2
6up0 RNA X-ray (2.8 Å) Jeng SCY, Trachman III RJ, Weissenboeck F, Truong L, Link KA, Jepsen MDE, Knutson JR, Andersen ES, Ferre-D'Amare AR, Unrau PJ (2021) "Fluorogenic aptamers resolve the flexibility of RNA junctions using orientation-dependent FRET." Rna, 27, 433-444. doi: 10.1261/rna.078220.120. Structure of the mango-iii fluorescent aptamer bound to yo3-biotin . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UUUD, hybrid2, 3+1, 2(-P-P-Lw)
6v0l DNA NMR Wang KB, Dickerhoff J, Wu G, Yang D (2020) "PDGFR-beta Promoter Forms a Vacancy G-Quadruplex that Can Be Filled in by dGMP: Solution Structure and Molecular Recognition of Guanine Metabolites and Drugs." J.Am.Chem.Soc., 142, 5204-5211. doi: 10.1021/jacs.9b12770. Pdgfr-b promoter forms a g-vacancy quadruplex that can be complemented by dgmp: molecular structure and recognition of guanine derivatives and metabolites . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 2(-P-P-P)
6v9b RNA X-ray (2.4 Å) Trachman 3rd RJ, Cojocaru R, Wu D, Piszczek G, Ryckelynck M, Unrau PJ, Ferre-D'Amare AR (2020) "Structure-Guided Engineering of the Homodimeric Mango-IV Fluorescence Turn-on Aptamer Yields an RNA FRET Pair." Structure, 28, 776-785.e3. doi: 10.1016/j.str.2020.04.007. Co-crystal structure of the fluorogenic mango-iv homodimer bound to to1-biotin . 6 G-tetrads, 2 G4 helices, 2 G4 stems, UUUU, parallel, 4+0, 3(-P-P-P)
6v9d RNA X-ray (2.8 Å) Trachman 3rd RJ, Cojocaru R, Wu D, Piszczek G, Ryckelynck M, Unrau PJ, Ferre-D'Amare AR (2020) "Structure-Guided Engineering of the Homodimeric Mango-IV Fluorescence Turn-on Aptamer Yields an RNA FRET Pair." Structure, 28, 776-785.e3. doi: 10.1016/j.str.2020.04.007. Co-crystal structure of the fluorogenic mango-iv homodimer bound to to1-biotin . 6 G-tetrads, 2 G4 helices, 2 G4 stems, UUUU, parallel, 4+0, 3(-P-P-P)
6w9p DNA X-ray (1.99 Å) Beseiso D, Chen EV, McCarthy SE, Martin KN, Gallagher EP, Miao J, Yatsunyk LA (2022) "The first crystal structures of hybrid and parallel four-tetrad intramolecular G-quadruplexes." Nucleic Acids Res., 50, 2959-2972. doi: 10.1093/nar/gkac091. Tel26 parallel four-quartet g-quadruplex with k+ . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 4(-P-P-P)
6wck DNA X-ray (1.801 Å) Ou A, Schmidberger JW, Wilson KA, Evans CW, Hargreaves JA, Grigg M, O'Mara ML, Iyer KS, Bond CS, Smith NM (2020) "High resolution crystal structure of a KRAS promoter G-quadruplex reveals a dimer with extensive poly-A pi-stacking interactions for small-molecule recognition." Nucleic Acids Res., 48, 5766-5776. doi: 10.1093/nar/gkaa262. Kras g-quadruplex g16t mutant with bromo uracil replacing t8 and t16. . 6 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, UUUU, parallel, 4+0, 3(-P-P-P), coaxial interfaces: 5'/5'
6xcl DNA X-ray (2.7 Å) Miron CE, van Staalduinen L, Rangaswamy AM, Chen M, Liang Y, Jia Z, Mergny JL, Petitjean A (2021) "Going Platinum to the Tune of a Remarkable Guanine Quadruplex Binder: Solution- and Solid-State Investigations." Angew.Chem.Int.Ed.Engl., 60, 2500-2507. doi: 10.1002/anie.202012520. Crystal structure of human telomeric DNA g-quadruplex in complex with a novel platinum(ii) complex. . 6 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, UUUU, parallel, 4+0, 3(-P-P-P), coaxial interfaces: 5'/5'
6xrq RNA X-ray (1.21 Å) Zhang Y, Bux K, Attana F, Wei D, Haider S, Parkinson GN (2024) "Structural descriptions of ligand interactions to RNA quadruplexes folded from the non-coding region of Pseudorabies virus." Biochimie. doi: 10.1016/j.biochi.2024.06.003. Structural descriptions of ligand interactions to DNA and RNA quadruplexes folded from the non-coding region of pseudorabies virus . 4 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, UUUU, parallel, 4+0, coaxial interfaces: 3'/5'
6xt7 DNA X-ray (1.56 Å) Beseiso D, Chen EV, McCarthy SE, Martin KN, Gallagher EP, Miao J, Yatsunyk LA (2022) "The first crystal structures of hybrid and parallel four-tetrad intramolecular G-quadruplexes." Nucleic Acids Res., 50, 2959-2972. doi: 10.1093/nar/gkac091. Tel25 hybrid four-quartet g-quadruplex with k+ . 16 G-tetrads, 4 G4 helices, 4 G4 stems, UUDU, hybrid1, 3+1, 3(-P-Lw-Ln)
6ycv DNA NMR Haase L, Weisz K (2020) "Locked nucleic acid building blocks as versatile tools for advanced G-quadruplex design." Nucleic Acids Res., 48, 10555-10566. doi: 10.1093/nar/gkaa720. 2'-f-riboguanosine and lna modified hybrid type g-quadruplex with v-loop . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UDDD, hybrid4, 1+3, 2(-LwX+P)
6yep DNA NMR Haase L, Weisz K (2020) "Locked nucleic acid building blocks as versatile tools for advanced G-quadruplex design." Nucleic Acids Res., 48, 10555-10566. doi: 10.1093/nar/gkaa720. Lna modified g-quadruplex with flipped g-tract and central tetrad . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUDD, anti-parallel:basket2, 2+2, 3(+LnD-Lw)
6yy4 DNA NMR Volek M, Kolesnikova S, Svehlova K, Srb P, Sgallova R, Streckerova T, Redondo JA, Veverka V, Curtis EA (2021) "Overlapping but distinct: a new model for G-quadruplex biochemical specificity." Nucleic Acids Res., 49, 1816-1827. doi: 10.1093/nar/gkab037. Parallel 17-mer DNA g-quadruplex . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
6z8v hydrolase X-ray (1.58 Å) Smirnov I, Kolganova N, Troisi R, Sica F, Timofeev E (2021) "Expanding the recognition interface of the thrombin-binding aptamer HD1 through modification of residues T3 and T12." Mol Ther Nucleic Acids, 23, 863-871. doi: 10.1016/j.omtn.2021.01.004. X-ray structure of the complex between human alpha thrombin and a thrombin binding aptamer variant (tba-3l), which contains 1-beta-d-lactopyranosyl residue in the side chain of thy3 at n3. . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
6z8w hydrolase X-ray (1.73 Å) Smirnov I, Kolganova N, Troisi R, Sica F, Timofeev E (2021) "Expanding the recognition interface of the thrombin-binding aptamer HD1 through modification of residues T3 and T12." Mol Ther Nucleic Acids, 23, 863-871. doi: 10.1016/j.omtn.2021.01.004. X-ray structure of the complex between human alpha thrombin and a thrombin binding aptamer variant (tba-3g), which contains 1-beta-d-glucopyranosyl residue in the side chain of thy3 at n3. . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
6z8x hydrolase X-ray (2.53 Å) Smirnov I, Kolganova N, Troisi R, Sica F, Timofeev E (2021) "Expanding the recognition interface of the thrombin-binding aptamer HD1 through modification of residues T3 and T12." Mol Ther Nucleic Acids, 23, 863-871. doi: 10.1016/j.omtn.2021.01.004. X-ray structure of the complex between human alpha thrombin and a thrombin binding aptamer variant (tba-3leu), which contains leucyl amide in the side chain of thy3 at n3. . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Ln)
6zl2 DNA NMR Vianney YM, Preckwinkel P, Mohr S, Weisz K (2020) "Quadruplex-Duplex Junction: A High-Affinity Binding Site for Indoloquinoline Ligands." Chemistry, 26, 16910-16922. doi: 10.1002/chem.202003540. Structure of a parallel c-myc modified with 3' duplex stem-loop overhang . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
6zl9 DNA NMR Vianney YM, Preckwinkel P, Mohr S, Weisz K (2020) "Quadruplex-Duplex Junction: A High-Affinity Binding Site for Indoloquinoline Ligands." Chemistry, 26, 16910-16922. doi: 10.1002/chem.202003540. Structure of a parallel c-myc modified with 5' duplex stem-loop overhang . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
6zrm DNA NMR Lenarcic Zivkovic M, Rozman J, Plavec J (2020) "Structure of a DNA G-Quadruplex Related to Osteoporosis with a G-A Bulge Forming a Pseudo-loop ." Molecules, 25. doi: 10.3390/molecules25204867. G-quadruplex with a g-a bulge . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
6zte DNA NMR Vianney YM, Preckwinkel P, Mohr S, Weisz K (2020) "Quadruplex-Duplex Junction: A High-Affinity Binding Site for Indoloquinoline Ligands." Chemistry, 26, 16910-16922. doi: 10.1002/chem.202003540. Structure of a parallel c-myc modified with 5' duplex stem-loop and 3' diagonal snap-back loop . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 2(-P-P-P)
6zx6 DNA NMR Bielskute S, Plavec J, Podbevsek P (2021) "Oxidative lesions modulate G-quadruplex stability and structure in the human BCL2 promoter." Nucleic Acids Res., 49, 2346-2356. doi: 10.1093/nar/gkab057. Antiparallel basket-type g-quadruplex DNA structure formed in human bcl-2 promoter containing 8-oxog . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UDDU, anti-parallel:basket, 2+2, 3(-LwD+Ln)
6zx7 DNA NMR Bielskute S, Plavec J, Podbevsek P (2021) "Oxidative lesions modulate G-quadruplex stability and structure in the human BCL2 promoter." Nucleic Acids Res., 49, 2346-2356. doi: 10.1093/nar/gkab057. Antiparallel basket-type g-quadruplex DNA structure formed in human bcl-2 promoter . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UDDU, anti-parallel:basket, 2+2, 3(-LwD+Ln)
7alu DNA NMR De Rache A, Marquevielle J, Bouaziz S, Vialet B, Andreola ML, Mergny JL, Amrane S (2023) "Structure of a DNA G-quadruplex that modulates SP1 binding sites architecture in HIV-1 promoter." J.Mol.Biol., 168359. doi: 10.1016/j.jmb.2023.168359. NMR structure of a DNA g-quadruplex containing two sp1 binding sites from hiv-1 promoter . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UDUU, hybrid3, 3+1, 3(-Lw-Ln-P)
7atz DNA NMR Vianney YM, Weisz K (2021) "First Tandem Repeat of a Potassium Channel KCNN4 Minisatellite Folds into a V-Loop G-Quadruplex Structure." Biochemistry, 60, 1337-1346. doi: 10.1021/acs.biochem.1c00043. G-quadruplex with v-shaped loop from the first repeat of kcnn4 minisatellite . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UDDD, hybrid4, 1+3, 2(-LwX+P)
7cls DNA NMR Ngoc Nguyen TQ, Lim KW, Phan AT (2020) "Duplex formation in a G-quadruplex bulge." Nucleic Acids Res., 48, 10567-10575. doi: 10.1093/nar/gkaa738. Solution structure of an intramolecular g-quadruplex containing a duplex bulge . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
7cps DNA NMR Barthwal R, Tariq Z, Pandav K "A 2:1 stoichiometric complex of anticancer drug 4'-Epiadriamycin bound to parallel G-quadruplex DNA [d-(TTGGGGT)]4." A 2:1 stoichiometric complex of anticancer drug 4'-epiadriamycin bound to parallel g-quadruplex DNA [d-(ttggggt)]4. . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0
7csk DNA NMR Barthwal R, Tariq Z, Pandav K "A 2:1 stoichiometric complex of anticancer drug Adriamycin bound to parallel G-quadruplex DNA [d-(TTGGGGT)]4." A 2:1 stoichiometric complex of anticancer drug adriamycin bound to parallel g-quadruplex DNA [d-(ttggggt)]4. . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0
7cv3 DNA NMR Tan DJY, Winnerdy FR, Lim KW, Phan AT (2020) "Coexistence of two quadruplex-duplex hybrids in the PIM1 gene." Nucleic Acids Res., 48, 11162-11171. doi: 10.1093/nar/gkaa752. Quadruplex-duplex hybrid structure in the pim1 gene, form 1 . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUDU, hybrid1, 3+1, 3(-P-Lw-Ln)
7cv4 DNA NMR Tan DJY, Winnerdy FR, Lim KW, Phan AT (2020) "Coexistence of two quadruplex-duplex hybrids in the PIM1 gene." Nucleic Acids Res., 48, 11162-11171. doi: 10.1093/nar/gkaa752. Quadruplex-duplex hybrid structure in the pim1 gene, form 2 . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
7d31 DNA X-ray (1.396 Å) Liu H, Gao Y, Mathivanan J, Shen F, Chen X, Li Y, Shao Z, Zhang Y, Shao Q, Sheng J, Gan J (2022) "Structure-guided development of Pb 2+ -binding DNA aptamers." Sci Rep, 12, 460. doi: 10.1038/s41598-021-04243-2. The tba-pb2+ complex in p41212 space group . 4 G-tetrads, 2 G4 helices, 2 G4 stems, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
7d32 DNA X-ray (1.707 Å) Liu H, Gao Y, Mathivanan J, Shen F, Chen X, Li Y, Shao Z, Zhang Y, Shao Q, Sheng J, Gan J (2022) "Structure-guided development of Pb 2+ -binding DNA aptamers." Sci Rep, 12, 460. doi: 10.1038/s41598-021-04243-2. The tba-pb2+ complex in p41212 space group . 4 G-tetrads, 2 G4 helices, 2 G4 stems, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
7d33 DNA X-ray (2.117 Å) Liu H, Gao Y, Mathivanan J, Shen F, Chen X, Li Y, Shao Z, Zhang Y, Shao Q, Sheng J, Gan J (2022) "Structure-guided development of Pb 2+ -binding DNA aptamers." Sci Rep, 12, 460. doi: 10.1038/s41598-021-04243-2. The pb2+ complexed structure of tba g8c mutant . 4 G-tetrads, 2 G4 helices, 2 G4 stems, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
7d5d DNA X-ray (1.18 Å) Das P, Ngo KH, Winnerdy FR, Maity A, Bakalar B, Mechulam Y, Schmitt E, Phan AT (2021) "Bulges in left-handed G-quadruplexes." Nucleic Acids Res., 49, 1724-1736. doi: 10.1093/nar/gkaa1259. Left-handed g-quadruplex containing one bulge . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 2(+P+P+P), negative twist
7d5e DNA X-ray (1.296 Å) Das P, Ngo KH, Winnerdy FR, Maity A, Bakalar B, Mechulam Y, Schmitt E, Phan AT (2021) "Bulges in left-handed G-quadruplexes." Nucleic Acids Res., 49, 1724-1736. doi: 10.1093/nar/gkaa1259. Left-handed g-quadruplex containing two bulges . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 2(+P+P+P), negative twist
7d5f DNA NMR Das P, Ngo KH, Winnerdy FR, Maity A, Bakalar B, Mechulam Y, Schmitt E, Phan AT (2021) "Bulges in left-handed G-quadruplexes." Nucleic Acids Res., 49, 1724-1736. doi: 10.1093/nar/gkaa1259. Left-handed g-quadruplex containing 3 bulges . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 2(+P+P+P), negative twist
7dfy DNA X-ray (1.69 Å) Das P, Winnerdy FR, Maity A, Mechulam Y, Phan AT (2021) "A novel minimal motif for left-handed G-quadruplex formation." Chem.Commun.(Camb.), 57, 2527-2530. doi: 10.1039/d0cc08146a. Novel motif for left-handed g-quadruplex formation . 8 G-tetrads, 2 G4 helices, 4 G4 stems, 2 G4 coaxial stacks, UUUU, parallel, 4+0, 2(+P+P+P), coaxial interfaces: 3'/3', negative twist
7do1 DNA NMR Fu W, Jing H, Xu X, Xu S, Wang T, Hu W, Li H, Zhang N (2021) "Two coexisting pseudo-mirror heteromolecular telomeric G-quadruplexes in opposite loop progressions differentially recognized by a low equivalent of Thioflavin T." Nucleic Acids Res., 49, 10717-10734. doi: 10.1093/nar/gkab755. Solution structure of a heteromolecular telomeric (3+1) g-quadruplex containing right loop progression . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UDUU, hybrid3, 3+1
7e5p DNA NMR Tsukakoshi K, Yamagishi Y, Kanazashi M, Nakama K, Oshikawa D, Savory N, Matsugami A, Hayashi F, Lee J, Saito T, Sode K, Khunathai K, Kuno H, Ikebukuro K (2021) "G-quadruplex-forming aptamer enhances the peroxidase activity of myoglobin against luminol." Nucleic Acids Res., 49, 6069-6081. doi: 10.1093/nar/gkab388. Aptamer enhancing peroxidase activity of myoglobin . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
7ecf DNA X-ray (1.6 Å) Geng Y, Liu C, Cai Q, Luo Z, Miao H, Shi X, Xu N, Fung CP, Choy TT, Yan B, Li N, Qian P, Zhou B, Zhu G (2021) "Crystal structure of parallel G-quadruplex formed by the two-repeat ALS- and FTD-related GGGGCC sequence." Nucleic Acids Res., 49, 5881-5890. doi: 10.1093/nar/gkab302. Crystal structure of d(g4c2)2-ba in c2221 space group . 8 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, UUUU, parallel, 4+0, coaxial interfaces: 5'/5'
7ecg DNA X-ray (1.97 Å) Geng Y, Liu C, Cai Q, Luo Z, Miao H, Shi X, Xu N, Fung CP, Choy TT, Yan B, Li N, Qian P, Zhou B, Zhu G (2021) "Crystal structure of parallel G-quadruplex formed by the two-repeat ALS- and FTD-related GGGGCC sequence." Nucleic Acids Res., 49, 5881-5890. doi: 10.1093/nar/gkab302. Crystal structure of d(g4c2)2-ba in f222 space group . 8 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, UUUU, parallel, 4+0, coaxial interfaces: 5'/5'
7ech DNA X-ray (2.38 Å) Geng Y, Liu C, Cai Q, Luo Z, Miao H, Shi X, Xu N, Fung CP, Choy TT, Yan B, Li N, Qian P, Zhou B, Zhu G (2021) "Crystal structure of parallel G-quadruplex formed by the two-repeat ALS- and FTD-related GGGGCC sequence." Nucleic Acids Res., 49, 5881-5890. doi: 10.1093/nar/gkab302. Crystal structure of d(g4c2)2-k in f222 space group . 8 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, UUUU, parallel, 4+0, coaxial interfaces: 5'/5'
7el7 DNA NMR Liu LY, Wang KN, Liu W, Zeng YL, Hou MX, Yang J, Mao ZW (2021) "Spatial Matching Selectivity and Solution Structure of Organic-Metal Hybrid to Quadruplex-Duplex Hybrid." Angew.Chem.Int.Ed.Engl., 60, 20833-20839. doi: 10.1002/anie.202106256. NMR solution structure of the 1:1 complex of a quadruplex-duplex hybrid myt1l and a platinum(ii) ligand l1pt(dien) . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UDUU, hybrid3, 3+1, 3(-Lw-Ln-P)
7euc DNA NMR Devi G, Winnerdy FR, Ang JCY, Lim KW, Phan AT (2022) "Four-Layered Intramolecular Parallel G-Quadruplex with Non-Nucleotide Loops: An Ultra-Stable Self-Folded DNA Nano-Scaffold." Acs Nano, 16, 533-540. doi: 10.1021/acsnano.1c07630. Parallel g-quadruplex structure . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0
7jku DNA X-ray (1.97 Å) Beseiso D, Chen EV, McCarthy SE, Martin KN, Gallagher EP, Miao J, Yatsunyk LA (2022) "The first crystal structures of hybrid and parallel four-tetrad intramolecular G-quadruplexes." Nucleic Acids Res., 50, 2959-2972. doi: 10.1093/nar/gkac091. Crystal structure of a four-tetrad, parallel, and k+ stabilized tetrahymena thermophila telomeric g-quadruplex . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 4(-P-P-P)
7kbv DNA NMR Dickerhoff J, Dai J, Yang D (2021) "Structural recognition of the MYC promoter G-quadruplex by a quinoline derivative: insights into molecular targeting of parallel G-quadruplexes." Nucleic Acids Res., 49, 5905-5915. doi: 10.1093/nar/gkab330. Solution structure of the major myc promoter g-quadruplex with a wild-type flanking sequence . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
7kbw DNA NMR Dickerhoff J, Dai J, Yang D (2021) "Structural recognition of the MYC promoter G-quadruplex by a quinoline derivative: insights into molecular targeting of parallel G-quadruplexes." Nucleic Acids Res., 49, 5905-5915. doi: 10.1093/nar/gkab330. Solution structure of the major myc promoter g-quadruplex with a wild-type flanking in complex with nsc85697, a quinoline derivative . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
7kbx DNA NMR Dickerhoff J, Dai J, Yang D (2021) "Structural recognition of the MYC promoter G-quadruplex by a quinoline derivative: insights into molecular targeting of parallel G-quadruplexes." Nucleic Acids Res., 49, 5905-5915. doi: 10.1093/nar/gkab330. Solution structure of the major myc promoter g-quadruplex in complex with nsc85697, a quinoline derivative . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
7klp DNA X-ray (1.35 Å) Li K, Yatsunyk L, Neidle S (2021) "Water spines and networks in G-quadruplex structures." Nucleic Acids Res., 49, 519-528. doi: 10.1093/nar/gkaa1177. Crystal structure of a three-tetrad, parallel, k+ stabilized human telomeric g-quadruplex . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
7l0z RNA X-ray (2.1 Å) Jeng SCY, Trachman III RJ, Weissenboeck F, Truong L, Link KA, Jepsen MDE, Knutson JR, Andersen ES, Ferre-D'Amare AR, Unrau PJ (2021) "Fluorogenic aptamers resolve the flexibility of RNA junctions using orientation-dependent FRET." Rna, 27, 433-444. doi: 10.1261/rna.078220.120. Spinach variant bound to dfhbi-1t . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UUDD, anti-parallel:basket2, 2+2, 2(-PD+P)
7ll0 DNA X-ray (2.0 Å) Beseiso D, Chen EV, McCarthy SE, Martin KN, Gallagher EP, Miao J, Yatsunyk LA (2022) "The first crystal structures of hybrid and parallel four-tetrad intramolecular G-quadruplexes." Nucleic Acids Res., 50, 2959-2972. doi: 10.1093/nar/gkac091. Crystal structure of a four-tetrad, parallel, and k+ stabilized tetrahymena thermophila telomeric g-quadruplex . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 4(-P-P-P)
7mkt RNA X-ray (1.97 Å) Roschdi S, Yan J, Nomura Y, Escobar CA, Petersen RJ, Bingman CA, Tonelli M, Vivek R, Montemayor EJ, Wickens M, Kennedy SG, Butcher SE (2022) "An atypical RNA quadruplex marks RNAs as vectors for gene silencing." Nat.Struct.Mol.Biol., 29, 1113-1121. doi: 10.1038/s41594-022-00854-z. Crystal structure of r(gu)11g-nmm complex . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 2(-P-P-P)
7msv DNA NMR Wang KB, Dickerhoff J, Yang D (2021) "Solution Structure of Ternary Complex of Berberine Bound to a dGMP-Fill-In Vacancy G-Quadruplex Formed in the PDGFR-beta Promoter." J.Am.Chem.Soc., 143, 16549-16555. doi: 10.1021/jacs.1c06200. Solution structure of berberine bound to a dgmp fill-in g-quadruplex in the pdgfr-b promoter . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 2(-P-P-P)
7n7d DNA NMR Dickerhoff J, Brundridge N, McLuckey SA, Yang D (2021) "Berberine Molecular Recognition of the Parallel MYC G-Quadruplex in Solution." J.Med.Chem., 64, 16205-16212. doi: 10.1021/acs.jmedchem.1c01508. Solution structure of the myc promoter g-quadruplex in complex with berberine: conformer a . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
7n7e DNA NMR Dickerhoff J, Brundridge N, McLuckey SA, Yang D (2021) "Berberine Molecular Recognition of the Parallel MYC G-Quadruplex in Solution." J.Med.Chem., 64, 16205-16212. doi: 10.1021/acs.jmedchem.1c01508. Solution structure of the myc promoter g-quadruplex in complex with berberine: conformer b . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
7ntu hydrolase X-ray (3.1 Å) Troisi R, Balasco N, Santamaria A, Vitagliano L, Sica F (2021) "Structural and functional analysis of the simultaneous binding of two duplex/quadruplex aptamers to human alpha-thrombin." Int.J.Biol.Macromol., 181, 858-867. doi: 10.1016/j.ijbiomac.2021.04.076. X-ray structure of the complex between human alpha thrombin and two duplex-quadruplex aptamers: nu172 and hd22_27mer . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
7nwd DNA NMR Peterkova K, Durnik I, Marek R, Plavec J, Podbevsek P (2021) "c-kit2 G-quadruplex stabilized via a covalent probe: exploring G-quartet asymmetry." Nucleic Acids Res., 49, 8947-8960. doi: 10.1093/nar/gkab659. Three-quartet c-kit2 g-quadruplex stabilized by a pyrene conjugate . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
7o1h DNA NMR Mohr S, Jana J, Vianney YM, Weisz K (2021) "Expanding the Topological Landscape by a G-Column Flip of a Parallel G-Quadruplex." Chemistry, 27, 10437-10447. doi: 10.1002/chem.202101181. Hybrid-2r quadruplex-duplex with (-p-p-l) topology and 3 syn residues . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUD, hybrid2, 3+1, 3(-P-P-Lw)
7oa3 RNA X-ray (2.8 Å) Mieczkowski M, Steinmetzger C, Bessi I, Lenz AK, Schmiedel A, Holzapfel M, Lambert C, Pena V, Hobartner C (2021) "Large Stokes shift fluorescence activation in an RNA aptamer by intermolecular proton transfer to guanine." Nat Commun, 12, 3549. doi: 10.1038/s41467-021-23932-0. Crystal structure of chili RNA aptamer in complex with dmhbo+ (iridium hexammine co-crystallized form) . 2 G-tetrads, 1 G4 helix
7oar hydrolase X-ray (2.58 Å) Dai YX, Guo HL, Liu NN, Chen WF, Ai X, Li HH, Sun B, Hou XM, Rety S, Xi XG (2022) "Structural mechanism underpinning Thermus oshimai Pif1-mediated G-quadruplex unfolding." Embo Rep., 23, e53874. doi: 10.15252/embr.202153874. Crystal structure of helicase pif1 from thermus oshimai in complex with parallel g-quadruplex . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
7oav RNA X-ray (2.99 Å) Mieczkowski M, Steinmetzger C, Bessi I, Lenz AK, Schmiedel A, Holzapfel M, Lambert C, Pena V, Hobartner C (2021) "Large Stokes shift fluorescence activation in an RNA aptamer by intermolecular proton transfer to guanine." Nat Commun, 12, 3549. doi: 10.1038/s41467-021-23932-0. Crystal structure of chili RNA aptamer in complex with dmhbo+ (iridium iii hexammine soaking crystal form) . 8 G-tetrads, 4 G4 helices
7oaw RNA X-ray (2.95 Å) Mieczkowski M, Steinmetzger C, Bessi I, Lenz AK, Schmiedel A, Holzapfel M, Lambert C, Pena V, Hobartner C (2021) "Large Stokes shift fluorescence activation in an RNA aptamer by intermolecular proton transfer to guanine." Nat Commun, 12, 3549. doi: 10.1038/s41467-021-23932-0. Crystal structure of the chili RNA aptamer in complex with dmhbi+ . 8 G-tetrads, 4 G4 helices
7oax RNA X-ray (2.24 Å) Mieczkowski M, Steinmetzger C, Bessi I, Lenz AK, Schmiedel A, Holzapfel M, Lambert C, Pena V, Hobartner C (2021) "Large Stokes shift fluorescence activation in an RNA aptamer by intermolecular proton transfer to guanine." Nat Commun, 12, 3549. doi: 10.1038/s41467-021-23932-0. Crystal structure of the chili RNA aptamer in complex with dmhbo+ . 8 G-tetrads, 4 G4 helices
7oqt DNA NMR Marquevielle J, De Rache A, Vialet B, Morvan E, Mergny JL, Amrane S (2022) "G-quadruplex structure of the C. elegans telomeric repeat: a two tetrads basket type conformation stabilized by a non-canonical C-T base-pair." Nucleic Acids Res., 50, 7134-7146. doi: 10.1093/nar/gkac523. G-quadruplex structure of the c. elegans telomeric repeat: a two tetrads basket type conformation stabilised by a hoogsteen c-t base-pair . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UDDU, anti-parallel:basket, 2+2, 2(-LwD+Ln)
7otb DNA X-ray (1.6 Å) McQuaid KT, Takahashi S, Baumgaertner L, Cardin DJ, Paterson NG, Hall JP, Sugimoto N, Cardin CJ (2022) "Ruthenium Polypyridyl Complex Bound to a Unimolecular Chair-Form G-Quadruplex." J.Am.Chem.Soc., 144, 5956-5964. doi: 10.1021/jacs.2c00178. Ruthenium polypridyl complex bound to a unimolecular chair-form g-quadruplex . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UDUD, anti-parallel:chair, 2+2, 3(-Lw-Ln-Lw)
7pne DNA NMR Vianney YM, Weisz K (2022) "Indoloquinoline Ligands Favor Intercalation at Quadruplex-Duplex Interfaces." Chemistry, 28, e202103718. doi: 10.1002/chem.202103718. Parallel q-d hybrid with 3' duplex stem-loop as a lateral snapback loop . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 2(-P-P-P)
7png DNA NMR Vianney YM, Weisz K (2022) "Indoloquinoline Ligands Favor Intercalation at Quadruplex-Duplex Interfaces." Chemistry, 28, e202103718. doi: 10.1002/chem.202103718. Solution structure of 1:1 complex of an indoloquinoline derivative syuiq-5 to parallel quadruplex-duplex (q-d) hybrid . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 2(-P-P-P)
7pnl DNA X-ray (1.83 Å) Nocentini A, Di Porzio A, Bonardi A, Bazzicalupi C, Petreni A, Biver T, Bua S, Marzano S, Amato J, Pagano B, Iaccarino N, De Tito S, Amente S, Supuran CT, Randazzo A, Gratteri P (2024) "Development of a multi-targeted chemotherapeutic approach based on G-quadruplex stabilisation and carbonic anhydrase inhibition." J Enzyme Inhib Med Chem, 39, 2366236. doi: 10.1080/14756366.2024.2366236. Complex between monomolecular human telomeric g-quadruplex and a sulfonamide derivative of the natural alkaloid berberine . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
7ps8 virus NMR Marquevielle J, Amrane S "NMR Structure of the U3 RNA G-quadruplex." NMR structure of the u3 RNA g-quadruplex . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
7q48 RNA NMR Wang Z, Jurt S, Dominguez-Martin A, Johannsen S, Sigel RKO "Solution structure of an intramolecular RNA G-quadruplex formed by the 6A8U17U mutant from a 22mer guanine-rich sequence within the 5'UTR of BCL-2 proto onco-gene." Solution structure of an intramolecular RNA g-quadruplex formed by the 6a8u17u mutant from a 22mer guanine-rich sequence within the 5'utr of bcl-2 proto onco-gene . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
7q6l RNA NMR Wang Z, Jurt S, Dominguez-Martin A, Johannsen S, Sigel RKO "Solution structure of an intramolecular RNA G-quadruplex formed by the 6A8A17U mutant from a 22mer guanine-rich sequence within the 5'UTR of BCL-2 proto-oncogene." Solution structure of an intramolecular RNA g-quadruplex formed by the 6a8a17u mutant from a 22mer guanine-rich sequence within the 5'utr of bcl-2 proto-oncogene . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
7qa2 RNA NMR Wang Z, Falk T, Jurt S, Johannsen S, Sigel RKO "Solution structure of an intramolecular RNA G-quadruplex formed by the 6A mutant from a 22mer guanine-rich sequence within the 5'UTR of BCL-2 proto-oncogene." Solution structure of an intramolecular RNA g-quadruplex formed by the 6a mutant from a 22mer guanine-rich sequence within the 5'utr of bcl-2 proto-oncogene . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
7qvq DNA X-ray (2.4 Å) Bazzicalupi C, Bonardi A, Biver T, Ferraroni M, Papi F, Savastano M, Lombardi P, Gratteri P (2022) "Probing the Efficiency of 13-Pyridylalkyl Berberine Derivatives to Human Telomeric G-Quadruplexes Binding: Spectroscopic, Solid State and In Silico Analysis." Int J Mol Sci, 23. doi: 10.3390/ijms232214061. Human telomeric DNA g-quadruplex of a gold(iii) complex containing the 2,4,6-tris (2-pyrimidyl)-1,3,5-triazine ligand . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
7sxp RNA X-ray (2.9 Å) Balaratnam S, Torrey ZR, Calabrese DR, Banco MT, Yazdani K, Liang X, Fullenkamp CR, Seshadri S, Holewinski RJ, Andresson T, Ferre-D'Amare AR, Incarnato D, Schneekloth Jr JS (2023) "Investigating the NRAS 5' UTR as a target for small molecules." Cell Chem Biol, 30, 643-657.e8. doi: 10.1016/j.chembiol.2023.05.004. G-quadruplex structure formed in the nras mrna with a g8u substitution . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P)
7v3t DNA NMR Zhu BC, He J, Xia XY, Jiang J, Liu W, Liu LY, Liang BB, Yao HG, Ke Z, Xia W, Mao ZW (2022) "Solution structure of a thrombin binding aptamer complex with a non-planar platinum(ii) compound." Chem Sci, 13, 8371-8379. doi: 10.1039/d2sc01196d. Solution structure of thrombin binding aptamer g-quadruplex bound a self-adaptive small molecule with rotated ligands . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
7v6v DNA NMR Hu W, Jing H, Fu W, Wang Z, Zhou J, Zhang N (2023) "Conversion to Trimolecular G-Quadruplex by Spontaneous Hoogsteen Pairing-Based Strand Displacement Reaction between Bimolecular G-Quadruplex and Double G-Rich Probes." J.Am.Chem.Soc. doi: 10.1021/jacs.3c05617. Trimolecular g-quadruplexes consists of a hairpin motif and two short chains . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0
7vf1 DNA NMR Maity A, Lim KW, Shneider NA, Chen G, Phan AT "A duplex-quadruplex hybrid formed by d[G4C2] repeats." Solution structure of a duplex-quadruplex hybrid formed by d[g4c2] repeats . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UUDD, anti-parallel:basket2, 2+2
7w0x DNA NMR Zhang N, Jing HT, Fu WQ "NMR structure of an alternating antiparallel tetrameric G-quadruplex assembled by the single-repeat of human telomeric DNA d(GGGTTA)." Tetrameric antiparallel g-quadruplex formed by natural human telomeric sequence . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UDUD, anti-parallel:chair, 2+2
7w9n DNA NMR Xu G, Zhao J, Yu H, Wang C, Huang Y, Zhao Q, Zhou X, Li C, Liu M (2022) "Structural Insights into the Mechanism of High-Affinity Binding of Ochratoxin A by a DNA Aptamer." J.Am.Chem.Soc., 144, 7731-7740. doi: 10.1021/jacs.2c00478. The structure of oba33-ota complex . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UDUD, anti-parallel:chair, 2+2, 2(-Lw-Ln-Lw)
7wgw DNA NMR Wang KB, Liu Y, Li Y, Dickerhoff J, Li J, Yang MH, Yang D, Kong LY (2022) "Oxidative Damage Induces a Vacancy G-Quadruplex That Binds Guanine Metabolites: Solution Structure of a cGMP Fill-in Vacancy G-Quadruplex in the Oxidized BLM Gene Promoter." J.Am.Chem.Soc., 144, 6361-6372. doi: 10.1021/jacs.2c00435. NMR solution structure of a cgmp fill-in vacancy g-quadruplex formed in the oxidized blm gene promoter . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 2(-P-P-P)
7x2z DNA NMR Liu L-Y, Ma TZ, Zeng YL, Liu W, Mao Z-W (2022) "Structural Basis of Pyridostatin and Its Derivatives Specifically Binding to G-Quadruplexes." J.Am.Chem.Soc., 144, 11878-11887. doi: 10.1021/jacs.2c04775. NMR solution structure of the 1:1 complex of a pyridostatin derivative (pypds) bound to a g-quadruplex myt1l . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UDUU, hybrid3, 3+1, 3(-Lw-Ln-P)
7x3a DNA NMR Liu L-Y, Ma TZ, Zeng YL, Liu W, Mao Z-W (2022) "Structural Basis of Pyridostatin and Its Derivatives Specifically Binding to G-Quadruplexes." J.Am.Chem.Soc., 144, 11878-11887. doi: 10.1021/jacs.2c04775. NMR solution structure of the 1:1 complex of a pyridostatin (pds) bound to a g-quadruplex myt1l . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UDUU, hybrid3, 3+1, 3(-Lw-Ln-P)
7x7g DNA X-ray (2.19 Å) Ngo KH, Liew CW, Lattmann S, Winnerdy FR, Phan AT (2022) "Crystal structures of an HIV-1 integrase aptamer: Formation of a water-mediated A.G.G.G.G pentad in an interlocked G-quadruplex." Biochem.Biophys.Res.Commun., 613, 153-158. doi: 10.1016/j.bbrc.2022.04.020. Crystal structure of a dimeric interlocked parallel g-quadruplex . 6 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, UUUU, parallel, 4+0, 2(-P-P-P), coaxial interfaces: 5'/5'-SEPARATED
7x8m DNA NMR Wang KB, Liu Y, Li J, Xiao C, Wang Y, Gu W, Li Y, Xia YZ, Yan T, Yang MH, Kong LY (2022) "Structural insight into the bulge-containing KRAS oncogene promoter G-quadruplex bound to berberine and coptisine." Nat Commun, 13, 6016. doi: 10.1038/s41467-022-33761-4. NMR solution structure of the 2:1 berberine-kras-g4 complex . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
7x8n DNA NMR Wang KB, Liu Y, Li J, Xiao C, Wang Y, Gu W, Li Y, Xia YZ, Yan T, Yang MH, Kong LY (2022) "Structural insight into the bulge-containing KRAS oncogene promoter G-quadruplex bound to berberine and coptisine." Nat Commun, 13, 6016. doi: 10.1038/s41467-022-33761-4. NMR solution structure of the wild-type bulge-containing kras-g4 . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
7x8o DNA NMR Wang KB, Liu Y, Li J, Xiao C, Wang Y, Gu W, Li Y, Xia YZ, Yan T, Yang MH, Kong LY (2022) "Structural insight into the bulge-containing KRAS oncogene promoter G-quadruplex bound to berberine and coptisine." Nat Commun, 13, 6016. doi: 10.1038/s41467-022-33761-4. NMR solution structure of the 2:1 coptisine-kras-g4 complex . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
7xdh DNA X-ray (1.83 Å) Ngo KH, Liew CW, Lattmann S, Winnerdy FR, Phan AT (2022) "Crystal structures of an HIV-1 integrase aptamer: Formation of a water-mediated A.G.G.G.G pentad in an interlocked G-quadruplex." Biochem.Biophys.Res.Commun., 613, 153-158. doi: 10.1016/j.bbrc.2022.04.020. Crystal structure of a dimeric interlocked parallel g-quadruplex . 6 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, UUUU, parallel, 4+0, 2(-P-P-P), coaxial interfaces: 5'/5'-SEPARATED
7xfv DNA NMR Zhang Y, Lan W, Wang C, Xue H, Cao C (2023) "Dimeric G-quadruplex DNA Structure in the Proximal Promoter of VEGFR-2 Reveals a New Drug Target to Inhibit Tumor Angiogenesis." Chin.J.Chem., 40, 2179-2187. doi: 10.1002/cjoc.202200260. Dimeric g-quadruplex DNA formed in the proximal promoter of vegfr-2 . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0
7xh9 DNA X-ray (1.63 Å) Ngo KH, Liew CW, Lattmann S, Winnerdy FR, Phan AT (2022) "Crystal structures of an HIV-1 integrase aptamer: Formation of a water-mediated A.G.G.G.G pentad in an interlocked G-quadruplex." Biochem.Biophys.Res.Commun., 613, 153-158. doi: 10.1016/j.bbrc.2022.04.020. Crystal structure of a dimeric interlocked parallel g-quadruplex . 6 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, UUUU, parallel, 4+0, 2(-P-P-P), coaxial interfaces: 5'/5'-SEPARATED
7xhd DNA X-ray (1.66 Å) Ngo KH, Liew CW, Lattmann S, Winnerdy FR, Phan AT (2022) "Crystal structures of an HIV-1 integrase aptamer: Formation of a water-mediated A•G•G•G•G pentad in an interlocked G-quadruplex." Biochem.Biophys.Res.Commun., 613, 153-158. doi: 10.1016/j.bbrc.2022.04.020. Crystal structure of a dimeric interlocked parallel g-quadruplex . 6 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, UUUU, parallel, 4+0, 2(-P-P-P), coaxial interfaces: 5'/5'-SEPARATED
7xie DNA X-ray (1.97 Å) Ngo KH, Liew CW, Lattmann S, Winnerdy FR, Phan AT (2022) "Crystal structures of an HIV-1 integrase aptamer: Formation of a water-mediated A•G•G•G•G pentad in an interlocked G-quadruplex." Biochem.Biophys.Res.Commun., 613, 153-158. doi: 10.1016/j.bbrc.2022.04.020. Crystal structure of a dimeric interlocked parallel g-quadruplex . 6 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, UUUU, parallel, 4+0, 2(-P-P-P), coaxial interfaces: 5'/5'-SEPARATED
7ys5 DNA NMR Yin S, Cao C "RET G-quadruplex in 10mM Na+." Ret g-quadruplex in 10mm na+ . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UDDD, hybrid4, 1+3, 2(D+PX)
7ys7 DNA NMR Yin S, Cao C "RET oncogene primer G-quadruplex in Na+." Ret oncogene primer g4-DNA in 100mmna+ . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UDDD, hybrid4, 1+3, 2(D+PX)
7z9l DNA NMR Ghosh A, Trajkovski M, Teulade-Fichou MP, Gabelica V, Plavec J (2022) "Phen-DC 3 Induces Refolding of Human Telomeric DNA into a Chair-Type Antiparallel G-Quadruplex through Ligand Intercalation." Angew.Chem.Int.Ed.Engl., 61, e202207384. doi: 10.1002/anie.202207384. Phen-dc3 intercalation causes hybrid-to-antiparallel transformation of human telomeric DNA g-quadruplex . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UDUD, anti-parallel:chair, 2+2, 3(+Ln+Lw+Ln)
7zek DNA NMR Jana J, Vianney YM, Schroder N, Weisz K (2022) "Guiding the folding of G-quadruplexes through loop residue interactions." Nucleic Acids Res., 50, 7161-7175. doi: 10.1093/nar/gkac549. Structure of a hybrid-type g-quadruplex with a snapback loop (hybrid 1r') . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UDDD, hybrid4, 1+3, 2(+Ln+P+P)
7zem DNA NMR Jana J, Vianney YM, Schroder N, Weisz K (2022) "Guiding the folding of G-quadruplexes through loop residue interactions." Nucleic Acids Res., 50, 7161-7175. doi: 10.1093/nar/gkac549. Structure of a parallel g-quadruplex with a snapback loop . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 2(-P-P-P)
7zeo DNA NMR Jana J, Vianney YM, Schroder N, Weisz K (2022) "Guiding the folding of G-quadruplexes through loop residue interactions." Nucleic Acids Res., 50, 7161-7175. doi: 10.1093/nar/gkac549. Structure of a hybrid-type g-quadruplex with a snapback loop and an all-syn g-column (hybrid-1r) . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UDDD, hybrid4, 1+3, 2(+Ln+P+P)
7zj4 RNA cryo-EM (4.43 Å) McRae EKS, Vallina NS, Hansen BK, Boussebayle A, Andersen ES "Structure determination of Pepper-Broccoli FRET pair by RNA origami scaffolding." Ligand bound state of a brocolli-pepper aptamer fret tile . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UUDD, anti-parallel:basket2, 2+2, 2(-PD+P)
7zj5 RNA cryo-EM (4.55 Å) McRae EKS, Vallina NS, Hansen BK, Boussebayle A, Andersen ES "Structure determination of Pepper-Broccoli FRET pair by RNA origami scaffolding." Unbound state of a brocolli-pepper aptamer fret tile. . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UUDD, anti-parallel:basket2, 2+2, 2(-PD+P)
7zkl hydrolase X-ray (3.18 Å) Troisi R, Riccardi C, Perez de Carvasal K, Smietana M, Morvan F, Del Vecchio P, Montesarchio D, Sica F (2022) "A terminal functionalization strategy reveals unusual binding abilities of anti-thrombin anticoagulant aptamers." Mol Ther Nucleic Acids, 30, 585-594. doi: 10.1016/j.omtn.2022.11.007. X-ray structure of the complex between human alpha thrombin and a pseudo-cyclic thrombin binding aptamer (tba-nnp-ddp) - crystal form alpha . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
7zkm hydrolase X-ray (2.0 Å) Troisi R, Riccardi C, Perez de Carvasal K, Smietana M, Morvan F, Del Vecchio P, Montesarchio D, Sica F (2022) "A terminal functionalization strategy reveals unusual binding abilities of anti-thrombin anticoagulant aptamers." Mol Ther Nucleic Acids, 30, 585-594. doi: 10.1016/j.omtn.2022.11.007. X-ray structure of the complex between human alpha thrombin and a pseudo-cyclic thrombin binding aptamer (tba-nnp-ddp) - crystal form beta . 4 G-tetrads, 2 G4 helices, 2 G4 stems, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Ln); UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
7zkn hydrolase X-ray (3.03 Å) Troisi R, Riccardi C, Perez de Carvasal K, Smietana M, Morvan F, Del Vecchio P, Montesarchio D, Sica F (2022) "A terminal functionalization strategy reveals unusual binding abilities of anti-thrombin anticoagulant aptamers." Mol Ther Nucleic Acids, 30, 585-594. doi: 10.1016/j.omtn.2022.11.007. X-ray structure of the complex between human alpha thrombin and a pseudo-cyclic thrombin binding aptamer (tba-nnp-ddp) - crystal form gamma . 4 G-tetrads, 2 G4 helices, 2 G4 stems, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Ln); UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
7zko hydrolase X-ray (2.5 Å) Troisi R, Riccardi C, Perez de Carvasal K, Smietana M, Morvan F, Del Vecchio P, Montesarchio D, Sica F (2022) "A terminal functionalization strategy reveals unusual binding abilities of anti-thrombin anticoagulant aptamers." Mol Ther Nucleic Acids, 30, 585-594. doi: 10.1016/j.omtn.2022.11.007. X-ray structure of the complex between human alpha thrombin and a pseudo-cyclic thrombin binding aptamer (tba-nnp-ddp) - crystal form delta . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Ln)
7zqs membrane protein cryo-EM (2.54 Å) Cheng EL, Cardle II, Kacherovsky N, Bansia H, Wang T, Zhou Y, Raman J, Yen A, Gutierrez D, Salipante SJ, des Georges A, Jensen MC, Pun SH (2022) "Discovery of a Transferrin Receptor 1-Binding Aptamer and Its Application in Cancer Cell Depletion for Adoptive T-Cell Therapy Manufacturing." J.Am.Chem.Soc., 144, 13851-13864. doi: 10.1021/jacs.2c05349. cryo-EM structure of human transferrin receptor 1 bound to DNA aptamer . 2 G-tetrads
7zur DNA X-ray (1.6 Å) Bazzicalupi C, Bonardi A, Biver T, Ferraroni M, Papi F, Savastano M, Lombardi P, Gratteri P (2022) "Probing the Efficiency of 13-Pyridylalkyl Berberine Derivatives to Human Telomeric G-Quadruplexes Binding: Spectroscopic, Solid State and In Silico Analysis." Int J Mol Sci, 23. doi: 10.3390/ijms232214061. Four carbons pendant pyridine derivative of the natural alkaloid berberine as human telomeric g-quadruplex binder . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0
8aad DNA X-ray (2.04 Å) Bazzicalupi C, Bonardi A, Biver T, Ferraroni M, Papi F, Savastano M, Lombardi P, Gratteri P (2022) "Probing the Efficiency of 13-Pyridylalkyl Berberine Derivatives to Human Telomeric G-Quadruplexes Binding: Spectroscopic, Solid State and In Silico Analysis." Int J Mol Sci, 23. doi: 10.3390/ijms232214061. Two carbons pendant pyridine derivative of the natural alkaloid berberine as human telomeric g-quadruplex binder . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0
8abd DNA NMR Vianney YM, Weisz K (2022) "High-affinity binding at quadruplex-duplex junctions: rather the rule than the exception." Nucleic Acids Res., 50, 11948-11964. doi: 10.1093/nar/gkac1088. Solution structure of phen-dc3 intercalating into a quadruplex-duplex hybrid . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 2(-P-P-P)
8abn DNA NMR Vianney YM, Weisz K (2022) "High-affinity binding at quadruplex-duplex junctions: rather the rule than the exception." Nucleic Acids Res., 50, 11948-11964. doi: 10.1093/nar/gkac1088. Solution structure of a phenyl-indoloquinoline intercalating into a quadruplex-duplex hybrid . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
8bw5 hydrolase X-ray (2.8 Å) Troisi R, Napolitano V, Rossitto E, Osman W, Nagano M, Wakui K, Popowicz GM, Yoshimoto K, Sica F (2023) "Steric hindrance and structural flexibility shape the functional properties of a guanine-rich oligonucleotide." Nucleic Acids Res., 51, 8880-8890. doi: 10.1093/nar/gkad634. X-ray structure of the complex between human alpha thrombin and the duplex-quadruplex aptamer m08s-1_41mer . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
8bzu DNA NMR Gajarsky M, Stadlbauer P, Sponer J, Cucchiarini A, Dobrovolna M, Brazda V, Mergny JL, Trantirek L, Lenarcic Zivkovic M (2024) "DNA Quadruplex Structure with a Unique Cation Dependency." Angew.Chem.Int.Ed.Engl., 63, e202313226. doi: 10.1002/anie.202313226. Double-ion dependent DNA quadruplex structure formed by c.elegans telomeric sequence . 1 G-tetrad
8c7a DNA NMR Zalar M, Wang B, Plavec J, Sket P (2023) "Insight into Tetramolecular DNA G-Quadruplexes Associated with ALS and FTLD: Cation Interactions and Formation of Higher-Ordered Structure." Int J Mol Sci, 24. doi: 10.3390/ijms241713437. Slow cation movements within tetramolecular g-quadruplex: vacant cation binding sites in addition to all syn g-quartet . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0
8c7b DNA NMR Zalar M, Wang B, Plavec J, Sket P (2023) "Insight into Tetramolecular DNA G-Quadruplexes Associated with ALS and FTLD: Cation Interactions and Formation of Higher-Ordered Structure." Int J Mol Sci, 24. doi: 10.3390/ijms241713437. Slow cation movements within tetramolecular g-quadruplex: vacant cation binding sites in addition to all syn g-quartet . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0
8d78 DNA X-ray (2.12 Å) Beseiso D, Chen EV, Yatsunyk LA "Biophysical and structural characterization of telomeric G-quadruplexes from Tetrahymena thermophila in complex with N-Methyl Mesoporphyrin IX." Crystal structure of a ba stabilized four-tetrad, parallel tetrahymena thermophila telomeric g-quadruplex in complex with n-methyl mesoporphyrin ix . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 4(-P-P-P)
8d79 DNA X-ray (1.99 Å) Beseiso D, Chen EV, Yatsunyk LA "Biophysical and structural characterization of telomeric G-quadruplexes from Tetrahymena thermophila in complex with N-Methyl Mesoporphyrin IX." Crystal structure of a four-tetrad, parallel, and na+ stabilized tetrahymena thermophila telomeric g-quadruplex in complex with n-methyl mesoporphyrin ix . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 4(-P-P-P)
8dut DNA cryo-EM (7.4 Å) Monsen RC, Chua EYD, Hopkins JB, Chaires JB, Trent JO (2023) "Structure of a 28.5 kDa duplex-embedded G-quadruplex system resolved to 7.4 angstrom resolution with cryo-EM." Nucleic Acids Res., 51, 1943-1959. doi: 10.1093/nar/gkad014. Duplex-g-quadruplex-duplex (dgd) class_1 . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
8ebo DNA X-ray (1.98 Å) Ye M, Chen EV, Pfeil SH, Martin KN, Atrafi T, Yun S, Martinez Z, Yatsunyk LA (2022) "Homopurine guanine-rich sequences in complex with N-methyl mesoporphyrin IX form parallel G-quadruplex dimers and display a unique symmetry tetrad." Bioorg.Med.Chem., 77, 117112. doi: 10.1016/j.bmc.2022.117112. Homopurine parallel g-quadruplex from human chromosome 7 stabilized by k+ ions . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
8edp DNA X-ray (2.01 Å) Ye M, Chen EV, Pfeil SH, Martin KN, Atrafi T, Yun S, Martinez Z, Yatsunyk LA (2022) "Homopurine guanine-rich sequences in complex with N-methyl mesoporphyrin IX form parallel G-quadruplex dimers and display a unique symmetry tetrad." Bioorg.Med.Chem., 77, 117112. doi: 10.1016/j.bmc.2022.117112. Crystal structure of a three-tetrad, parallel, and k+ stabilized homopurine g-quadruplex from human chromosome 7 . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
8eyu RNA X-ray (1.95 Å) Passalacqua LFM, Starich MR, Link KA, Wu J, Knutson JR, Tjandra N, Jaffrey SR, Ferre-D'Amare AR (2023) "Co-crystal structures of the fluorogenic aptamer Beetroot show that close homology may not predict similar RNA architecture." Nat Commun, 14, 2969. doi: 10.1038/s41467-023-38683-3. Structure of beetroot dimer bound to dfame . 6 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, UUUU, parallel, 4+0, 2(-P-P-P), coaxial interfaces: 5'/5'
8eyv RNA X-ray (2.55 Å) Passalacqua LFM, Starich MR, Link KA, Wu J, Knutson JR, Tjandra N, Jaffrey SR, Ferre-D'Amare AR (2023) "Co-crystal structures of the fluorogenic aptamer Beetroot show that close homology may not predict similar RNA architecture." Nat Commun, 14, 2969. doi: 10.1038/s41467-023-38683-3. Structure of beetroot dimer bound to dfho . 6 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, UUUU, parallel, 4+0, 2(-P-P-P), coaxial interfaces: 5'/5'
8eyw RNA X-ray (2.1 Å) Passalacqua LFM, Starich MR, Link KA, Wu J, Knutson JR, Tjandra N, Jaffrey SR, Ferre-D'Amare AR (2023) "Co-crystal structures of the fluorogenic aptamer Beetroot show that close homology may not predict similar RNA architecture." Nat Commun, 14, 2969. doi: 10.1038/s41467-023-38683-3. Beetroot dimer bound to tht . 6 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, UUUU, parallel, 4+0, 2(-P-P-P), coaxial interfaces: 5'/5'
8f0n RNA X-ray (2.85 Å) Passalacqua LFM, Starich MR, Link KA, Wu J, Knutson JR, Tjandra N, Jaffrey SR, Ferre-D'Amare AR (2023) "Co-crystal structures of the fluorogenic aptamer Beetroot show that close homology may not predict similar RNA architecture." Nat Commun, 14, 2969. doi: 10.1038/s41467-023-38683-3. Wobble beetroot (a16u-u38g) dimer bound to dfho . 6 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, UUUU, parallel, 4+0, 2(-P-P-P), coaxial interfaces: 5'/5'
8fhv DNA X-ray (2.5 Å) Passalacqua LFM, Banco MT, Moon JD, Li X, Jaffrey SR, Ferre-D'Amare AR (2023) "Intricate 3D architecture of a DNA mimic of GFP." Nature, 618, 1078-1084. doi: 10.1038/s41586-023-06229-8. Structure of lettuce aptamer bound to dfhbi-1t with thallium i ions . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
8fhx DNA X-ray (2.5 Å) Passalacqua LFM, Banco MT, Moon JD, Li X, Jaffrey SR, Ferre-D'Amare AR (2023) "Intricate 3D architecture of a DNA mimic of GFP." Nature, 618, 1078-1084. doi: 10.1038/s41586-023-06229-8. Structure of lettuce aptamer bound to dfhbi-1t . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
8fhz DNA X-ray (2.6 Å) Passalacqua LFM, Banco MT, Moon JD, Li X, Jaffrey SR, Ferre-D'Amare AR (2023) "Intricate 3D architecture of a DNA mimic of GFP." Nature, 618, 1078-1084. doi: 10.1038/s41586-023-06229-8. Structure of lettuce aptamer bound to dfho . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
8fi0 DNA X-ray (3.0 Å) Passalacqua LFM, Banco MT, Moon JD, Li X, Jaffrey SR, Ferre-D'Amare AR (2023) "Intricate 3D architecture of a DNA mimic of GFP." Nature, 618, 1078-1084. doi: 10.1038/s41586-023-06229-8. Structure of lettuce aptamer bound to dfame . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
8fi1 DNA X-ray (2.6 Å) Passalacqua LFM, Banco MT, Moon JD, Li X, Jaffrey SR, Ferre-D'Amare AR (2023) "Intricate 3D architecture of a DNA mimic of GFP." Nature, 618, 1078-1084. doi: 10.1038/s41586-023-06229-8. Structure of lettuce c20g bound to dfho . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
8fi2 DNA X-ray (3.0 Å) Passalacqua LFM, Banco MT, Moon JD, Li X, Jaffrey SR, Ferre-D'Amare AR (2023) "Intricate 3D architecture of a DNA mimic of GFP." Nature, 618, 1078-1084. doi: 10.1038/s41586-023-06229-8. Structure of lettuce c20t bound to dfhbi-1t . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
8fi7 DNA X-ray (2.9 Å) Passalacqua LFM, Banco MT, Moon JD, Li X, Jaffrey SR, Ferre-D'Amare AR (2023) "Intricate 3D architecture of a DNA mimic of GFP." Nature, 618, 1078-1084. doi: 10.1038/s41586-023-06229-8. Structure of lettuce c20t bound to dfho . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
8fi8 DNA X-ray (2.8 Å) Passalacqua LFM, Banco MT, Moon JD, Li X, Jaffrey SR, Ferre-D'Amare AR (2023) "Intricate 3D architecture of a DNA mimic of GFP." Nature, 618, 1078-1084. doi: 10.1038/s41586-023-06229-8. Structure of lettuce c20t bound to dfame . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
8fyh gene regulation cryo-EM (3.4 Å) Song J, Gooding AR, Hemphill WO, Love BD, Robertson A, Yao L, Zon LI, North TE, Kasinath V, Cech TR (2023) "Structural basis for inactivation of PRC2 by G-quadruplex RNA." Science, 381, 1331-1337. doi: 10.1126/science.adh0059. G4 RNA-mediated prc2 dimer . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0,
8g2n DNA X-ray (1.33 Å) Martin KN, Lam G, Reznichenko O, Brunner KE, Zdilla MJ, McCarthy SE, Granzhan A, Yatsunyk LA (2025) "Conformational Change in a Four-Tetrad DNA G-Quadruplex upon Intercalation of a Small-Molecule Ligand PyDH2." Angew.Chem.Int.Ed.Engl., 64, e202501443. doi: 10.1002/anie.202501443. Crystal structure of tetrahymena thermophila g-rich DNA with novel ligand pydh2 . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UDUD, anti-parallel:chair, 2+2, 4(+Ln+Lw+Ln)
8gp7 DNA NMR Yin S, Lan W, Hou X, Liu Z, Xue H, Wang C, Tang GL, Cao C (2023) "Trioxacarcin A Interactions with G-Quadruplex DNA Reveal Its Potential New Targets as an Anticancer Agent." J.Med.Chem., 66, 6798-6810. doi: 10.1021/acs.jmedchem.3c00178. Structure of trioxacarcin a covalently bound to ret g4-DNA . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
8ht7 DNA binding protein NMR Geng Y, Liu C, Xu N, Shi X, Suen MC, Zhou B, Yan B, Wu C, Li H, Song Y, Chen X, Wang Z, Cai Q, Zhu G (2024) "The N-terminal region of Cdc6 specifically recognizes human DNA G-quadruplex." Int.J.Biol.Macromol., 260, 129487. doi: 10.1016/j.ijbiomac.2024.129487. The n-terminal region of cdc6 specifically recognizes human DNA g-quadruplex . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UDUD, anti-parallel:chair, 2+2, 3(+Ln+Lw+Ln)
8ijc DNA NMR Liu LY, Ma TZ, Zeng YL, Liu W, Zhang H, Mao ZW (2023) "Organic-Platinum Hybrids for Covalent Binding of G-Quadruplexes: Structural Basis and Application to Cancer Immunotherapy." Angew.Chem.Int.Ed.Engl., 62, e202305645. doi: 10.1002/anie.202305645. NMR solution structure of the 1:1 complex of a platinum(ii) ligand l1-transpt covalently bound to a g-quadruplex myt1l . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UDUU, hybrid3, 3+1, 3(-Lw-Ln-P)
8ipp DNA binding protein-DNA X-ray (2.007 Å) Ngo KH, Liew CW, Heddi B, Phan AT (2024) "Structural Basis for Parallel G-Quadruplex Recognition by an Ankyrin Protein." J.Am.Chem.Soc., 146, 13709-13713. doi: 10.1021/jacs.4c01971. Crystal structure of the complex between an ankyrin and a parallel g-quadruplex . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 2(-P-P-P)
8jfq DNA NMR Liu Y, Li J, Zhang Y, Wang Y, Chen J, Bian Y, Xia Y, Yang MH, Zheng K, Wang KB, Kong LY (2023) "Structure of the Major G-Quadruplex in the Human EGFR Oncogene Promoter Adopts a Unique Folding Topology with a Distinctive Snap-Back Loop." J.Am.Chem.Soc., 145, 16228-16237. doi: 10.1021/jacs.3c05214. Structure of the major g-quadruplex in the human egfr oncogene promoter adopts a unique folding topology with a distinctive snap-back loop . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 2(-P-P-P)
8jic DNA NMR Galer P, Wang B, Plavec J, Sket P (2023) "Unveiling the structural mechanism of a G-quadruplex pH-Driven switch." Biochimie, 214, 73-82. doi: 10.1016/j.biochi.2023.08.002. Human telomere two-quartet g-quadruplex at ph 7.0 . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UDDU, anti-parallel:basket, 2+2, 2(-LwD+Ln)
8jih DNA NMR Galer P, Wang B, Plavec J, Sket P (2023) "Unveiling the structural mechanism of a G-quadruplex pH-Driven switch." Biochimie, 214, 73-82. doi: 10.1016/j.biochi.2023.08.002. Human telomere two-quartet g-quadruplex at ph 5.0 . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UUDD, anti-parallel:basket2, 2+2, 2(+LnD-Lw)
8k7w RNA X-ray (2.24 Å) Ren Y, Lin X, Liao W, Peng X, Deng J, Zhang Z, Zhan J, Zhou Y, Westhof E, Lilley DMJ, Wang J, Huang L (2025) "A general strategy for engineering GU base pairs to facilitate RNA crystallization." Nucleic Acids Res., 53. doi: 10.1093/nar/gkae1218. Crystal structure of broccoli aptamer with dfhbi-1t . 4 G-tetrads, 2 G4 helices, 2 G4 stems, UUDD, anti-parallel:basket2, 2+2, 2(-PD+P)
8k85 RNA X-ray (2.95 Å) Peng X, Huang L "Structural analysis of various Broccoli aptamers with different Fluorophores." Crystal structure of red broccoli aptamer with obi . 4 G-tetrads, 2 G4 helices, 2 G4 stems, UUDD, anti-parallel:basket2, 2+2
8kf9 DNA NMR Zhang YP, Lan WX, Yin SW, Liu ZJ, Xue HJ, Cao CY "Stable G-quadruplex Conformation Formed in Promoter Region of Oncogene RET Indicates New Target for Anti-cancer Drug Screening." Stable g-quadruplex conformation formed in promoter region of oncogene ret in 50 mm k+ solution . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UDDD, hybrid4, 1+3, 2(D+PX)
8kfl DNA NMR Zhang YP, Lan WX, Yin SW, Liu ZJ, Xue HJ, Cao CY "Stable G-quadruplex Conformation Formed in Promoter Region of Oncogene RET Indicates New Target for Anti-cancer Drug Screening." Stable g-quadruplex conformation formed in promoter region of oncogene ret in 100 mm na+ . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UDDD, hybrid4, 1+3, 2(D+PX)
8p6b DNA X-ray (2.5 Å) McQuaid KT, Cardin CJ "Ruthenium complex bound to an antiparallel G-quadruplex." Ruthenium complex bound to a modified human telomeric sequence giving an antiparallel g-quadruplex . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UDUD, anti-parallel:chair, 2+2, 3(+Lm+Ln+Lw)
8psb DNA NMR Vianney YM, Schroder N, Jana J, Chojetzki G, Weisz K (2023) "Showcasing Different G-Quadruplex Folds of a G-Rich Sequence: Between Rule-Based Prediction and Butterfly Effect." J.Am.Chem.Soc., 145, 22194-22205. doi: 10.1021/jacs.3c08336. Three-layered parallel g-quadruplex with snapback loop from a g-rich sequence with five g-runs . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 2(-P-P-P)
8psc DNA NMR Vianney YM, Schroder N, Jana J, Chojetzki G, Weisz K (2023) "Showcasing Different G-Quadruplex Folds of a G-Rich Sequence: Between Rule-Based Prediction and Butterfly Effect." J.Am.Chem.Soc., 145, 22194-22205. doi: 10.1021/jacs.3c08336. Three-layered basket-type g-quadruplex from a g-rich sequence with five g-runs . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UDDU, anti-parallel:basket, 2+2, 3(-LwD+Ln)
8pse DNA NMR Vianney YM, Schroder N, Jana J, Chojetzki G, Weisz K (2023) "Showcasing Different G-Quadruplex Folds of a G-Rich Sequence: Between Rule-Based Prediction and Butterfly Effect." J.Am.Chem.Soc., 145, 22194-22205. doi: 10.1021/jacs.3c08336. (3+1) hybrid g-quadruplex from a g-rich sequence with five g-runs . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUD, hybrid2, 3+1, 3(-PD+Lw)
8psi DNA NMR Vianney YM, Schroder N, Jana J, Chojetzki G, Weisz K (2023) "Showcasing Different G-Quadruplex Folds of a G-Rich Sequence: Between Rule-Based Prediction and Butterfly Effect." J.Am.Chem.Soc., 145, 22194-22205. doi: 10.1021/jacs.3c08336. G-quadruplex with a 1-nt v-shaped loop from a g-rich sequence with five g-runs . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UDUD, anti-parallel:chair, 2+2, 2(-LwX+Lw)
8q4o RNA NMR Orehova M, Plavec J, Kocman V (2024) "High-Resolution Structure of RNA G-Quadruplex Containing Unique Structural Motifs Originating from the 5'-UTR of Human Tyrosine Kinase 2 (TYK2)." Acs Omega, 9, 7215-7229. doi: 10.1021/acsomega.3c09592. RNA g-quadruplex from the 5'-utr of human tyrosine kinase 2 (tyk2) . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
8qkx DNA NMR Agustin DF, Vianney YM, Weisz K, Wahjudi M (2024) "Structural Aspects of Split G-Quadruplexes in Quadruplex-Duplex Hybrid Systems." Chemistryselect. doi: 10.1002/slct.202304286. Solution structure of a bimolecular quadruplex-duplex hybrid containing a v-shaped loop . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UDUU, hybrid3, 3+1
8qn2 gene regulation X-ray (2.51 Å) Koenig A, Laffile V, Largy E, Thore S, Mackereth C, Ferrand Y, Gabelica V (2025) "Helical aromatic oligoamide foldamers as selective G-quadruplex ligands." Nucleic Acids Res. doi: 10.1093/nar/gkaf1365. Helical foldamers as selective g-quadruplex ligands . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
8r4e DNA NMR Jana J, Vianney YM, Weisz K (2024) "Impact of loop length and duplex extensions on the design of hybrid-type G-quadruplexes." Chem.Commun.(Camb.), 60, 854-857. doi: 10.1039/d3cc05625b. Hybrid-1r g-quadruplex with a +(lpp) loop progression . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UDDD, hybrid4, 1+3, 3(+Ln+P+P)
8r4w DNA NMR Jana J, Vianney YM, Weisz K (2024) "Impact of loop length and duplex extensions on the design of hybrid-type G-quadruplexes." Chem.Commun.(Camb.), 60, 854-857. doi: 10.1039/d3cc05625b. (3+1) hybrid-2 g-quadruplex with a -(llp) loop progression . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UDUU, hybrid3, 3+1, 3(-Lw-Ln-P)
8r6d DNA NMR Vianney YM, Dierks D, Weisz K (2024) "Structural Differences at Quadruplex-Duplex Interfaces Enable Ligand-Induced Topological Transitions." Adv Sci, 11, e2309891. doi: 10.1002/advs.202309891. A quadruplex-duplex hybrid with a three-layered hybrid-2 g-quadruplex topology . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UDUU, hybrid3, 3+1, 3(-Lw-Ln-P)
8r6g DNA NMR Vianney YM, Dierks D, Weisz K (2024) "Structural Differences at Quadruplex-Duplex Interfaces Enable Ligand-Induced Topological Transitions." Adv Sci, 11, e2309891. doi: 10.1002/advs.202309891. A quadruplex-duplex hybrid with a three-layered chair g-quadruplex topology . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UDUD, anti-parallel:chair, 2+2, 3(-Lw-Ln-Lw)
8r6h DNA NMR Vianney YM, Dierks D, Weisz K (2024) "Structural Differences at Quadruplex-Duplex Interfaces Enable Ligand-Induced Topological Transitions." Adv Sci, 11, e2309891. doi: 10.1002/advs.202309891. A quadruplex-duplex hybrid with a three-layered hybrid-2 g-quadruplex topology complexed with phen-dc3 . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UDUU, hybrid3, 3+1, 3(-Lw-Ln-P)
8rw2 DNA NMR Vianney YM, Jana J, Weisz K (2024) "A pH-Responsive Topological Switch Based on a DNA Quadruplex-Duplex Hybrid." Chemistry, 30, e202400722. doi: 10.1002/chem.202400722. Structure of a chair-type antiparallel quadruplex-duplex hybrid at ph 6 . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UDUD, anti-parallel:chair, 2+2, 3(-Lw-Ln-Lw)
8rzx DNA NMR Chatterjee O, Jana J, Panda S, Dutta A, Sharma A, Saurav S, Motiani RK, Weisz K, Chatterjee S (2024) "Remodeling Ca 2+ dynamics by targeting a promising E-box containing G-quadruplex at ORAI1 promoter in triple-negative breast cancer." Cell Calcium, 123, 102944. doi: 10.1016/j.ceca.2024.102944. Solution structure of a parallel stranded g-quadruplex formed in orai1 promoter . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
8s1w DNA NMR Vianney YM, Jana J, Weisz K (2024) "A pH-Responsive Topological Switch Based on a DNA Quadruplex-Duplex Hybrid." Chemistry, 30, e202400722. doi: 10.1002/chem.202400722. Structure of a quadruplex-duplex hybrid with a (-pd+l) loop progression . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUD, hybrid2, 3+1, 3(-PD+Lw)
8t8t DNA X-ray (1.62 Å) Martin KN, Lam G, Reznichenko O, Brunner KE, Zdilla MJ, McCarthy SE, Granzhan A, Yatsunyk LA (2025) "Conformational Change in a Four-Tetrad DNA G-Quadruplex upon Intercalation of a Small-Molecule Ligand PyDH2." Angew.Chem.Int.Ed.Engl., 64, e202501443. doi: 10.1002/anie.202501443. Crystal structure of tet25 in complex with pydh2 ligand in p212121 space group . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UDUD, anti-parallel:chair, 2+2, 4(+Ln+Lw+Ln)
8taa DNA X-ray (1.45 Å) Seth P, Xing E, Hendrickson AD, Li K, Monsen R, Chaires JB, Neidle S, Yatsunyk LA (2025) "Interaction of N-methylmesoporphyrin IX with a hybrid left-/right-handed G-quadruplex motif from the promoter of the SLC2A1 gene." Nucleic Acids Res., 53. doi: 10.1093/nar/gkae1208. Right-left hybrid parallel g-quadruplex in complex with n-methyl mesoporphyrin . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 2(-P-P-P)
8tns RNA multiple methods: solution nmr, solution scattering Escobar CA, Petersen RJ, Tonelli M, Fan L, Henzler-Wildman KA, Butcher SE (2023) "Solution Structure of Poly(UG) RNA." J.Mol.Biol., 435, 168340. doi: 10.1016/j.jmb.2023.168340. Solution structure of poly(ug) RNA (gu)12 g-quadruplex . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 2(-P-P-P), negative twist
8tqs blood clotting X-ray (2.207 Å) Yu H, Kumar S, Frederiksen JW, Kolyadko VN, Pitoc G, Layzer J, Yan A, Rempel R, Francis S, Krishnaswamy S, Sullenger BA (2024) "Aptameric hirudins as selective and reversible EXosite-ACTive site (EXACT) inhibitors." Nat Commun, 15, 3977. doi: 10.1038/s41467-024-48211-6. Complex of human thrombin (s195a) bound to a bivalent inhibitor comprised of DNA aptamer hd22 conjugated to dabigatran with a linker. . 1 G-tetrad
8tvz RNA cryo-EM (5.94 Å) Vallina NS, McRae EKS, Geary C, Andersen ES (2024) "An RNA origami robot that traps and releases a fluorescent aptamer." Sci Adv, 10, eadk1250. doi: 10.1126/sciadv.adk1250. RNA origami 3-helix tile traptamer . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UUDD, anti-parallel:basket2, 2+2, 2(-P+P)
8twh DNA X-ray (2.47 Å) Lam G, Martin KN, Yatsunyk LA "Crystal structure of (GGGTT)3GGG G-quadruplex in complex with small molecule ligand RHPS4." Crystal structure of (gggtt)3ggg g-quadruplex in complex with small molecule ligand rhps4 . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
8u5j RNA X-ray (1.7 Å) Lu X, Passalacqua LFM, Nodwell M, Kong KYS, Caballero-Garcia G, Dolgosheina EV, Ferre-D'Amare AR, Britton R, Unrau PJ (2024) "Symmetry breaking of fluorophore binding to a G-quadruplex generates an RNA aptamer with picomolar KD." Nucleic Acids Res., 52, 8039-8051. doi: 10.1093/nar/gkae493. Structure of mango iii variant aptamer bound to t01-07m-b . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UUUD, hybrid2, 3+1, 2(-P-P-Lw)
8u5k RNA X-ray (2.8 Å) Lu X, Passalacqua LFM, Nodwell M, Kong KYS, Caballero-Garcia G, Dolgosheina EV, Ferre-D'Amare AR, Britton R, Unrau PJ (2024) "Symmetry breaking of fluorophore binding to a G-quadruplex generates an RNA aptamer with picomolar KD." Nucleic Acids Res., 52, 8039-8051. doi: 10.1093/nar/gkae493. Structure of mango ii aptamer bound to t01-6a . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
8u5p RNA X-ray (2.9 Å) Lu X, Passalacqua LFM, Nodwell M, Kong KYS, Caballero-Garcia G, Dolgosheina EV, Ferre-D'Amare AR, Britton R, Unrau PJ (2024) "Symmetry breaking of fluorophore binding to a G-quadruplex generates an RNA aptamer with picomolar KD." Nucleic Acids Res., 52, 8039-8051. doi: 10.1093/nar/gkae493. Structure of mango ii aptamer bound to t01-6a-b . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
8u5r RNA X-ray (2.6 Å) Lu X, Passalacqua LFM, Nodwell M, Kong KYS, Caballero-Garcia G, Dolgosheina EV, Ferre-D'Amare AR, Britton R, Unrau PJ (2024) "Symmetry breaking of fluorophore binding to a G-quadruplex generates an RNA aptamer with picomolar KD." Nucleic Acids Res., 52, 8039-8051. doi: 10.1093/nar/gkae493. Structure of mango ii variant aptamer bound to t01-6a . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
8u5t RNA X-ray (2.2 Å) Lu X, Passalacqua LFM, Nodwell M, Kong KYS, Caballero-Garcia G, Dolgosheina EV, Ferre-D'Amare AR, Britton R, Unrau PJ (2024) "Symmetry breaking of fluorophore binding to a G-quadruplex generates an RNA aptamer with picomolar KD." Nucleic Acids Res., 52, 8039-8051. doi: 10.1093/nar/gkae493. Structure of mango ii variant aptamer bound to t01-6a-b . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
8u5z RNA X-ray (2.5 Å) Lu X, Passalacqua LFM, Nodwell M, Kong KYS, Caballero-Garcia G, Dolgosheina EV, Ferre-D'Amare AR, Britton R, Unrau PJ (2024) "Symmetry breaking of fluorophore binding to a G-quadruplex generates an RNA aptamer with picomolar KD." Nucleic Acids Res., 52, 8039-8051. doi: 10.1093/nar/gkae493. Structure of mango ii variant aptamer bound to t01-7m-b . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
8u60 RNA X-ray (3.3 Å) Lu X, Passalacqua LFM, Nodwell M, Kong KYS, Caballero-Garcia G, Dolgosheina EV, Ferre-D'Amare AR, Britton R, Unrau PJ (2024) "Symmetry breaking of fluorophore binding to a G-quadruplex generates an RNA aptamer with picomolar KD." Nucleic Acids Res., 52, 8039-8051. doi: 10.1093/nar/gkae493. Structure of mango ii variant2 aptamer bound to t01-6a . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
8utg RNA X-ray (1.97 Å) Terrell JR, Le TT, Paul A, Brinton MA, Wilson WD, Poon GMK, Germann MW, Siemer JL (2024) "Structure of an RNA G-quadruplex from the West Nile virus genome." Nat Commun, 15, 5428. doi: 10.1038/s41467-024-49761-5. An RNA g-quadruplex from the ns5 gene in the west nile virus genome . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 2(-P-P-P)
8vjt RNA X-ray (1.052 Å) Roschdi S, Montemayor EJ, Vivek R, Bingman CA, Butcher SE (2024) "Self-assembly and condensation of intermolecular poly(UG) RNA quadruplexes." Nucleic Acids Res., 52, 12582-12591. doi: 10.1093/nar/gkae870. Structure of the poly-ug quadruplex (gugugu)4 . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0
8vv2 hydrolase-RNA cryo-EM (2.6 Å) Banco MT, Paul T, Jiang J, Myong S, Ferre-D'Amare AR "Inter-domain synergy enables both DNA and RNA G-quadruplex unwinding by the DEAH-box helicase DHX36." cryo-EM structure of dhx36 bound to a RNA g-quadruplex derived from the cmyc g-quadruplex, class 1 . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0,
8vvd motor protein-RNA cryo-EM (3.0 Å) Banco MT, Paul T, Jiang J, Myong S, Ferre-D'Amare AR "Inter-domain synergy enables both DNA and RNA G-quadruplex unwinding by the DEAH-box helicase DHX36." cryo-EM structure of dhx36 bound to a RNA g-quadruplex derived from the cmyc g-quadruplex, class 2 . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0,
8vx1 motor protein cryo-EM (3.4 Å) Banco MT, Paul T, Jiang J, Myong S, Ferre-D'Amare AR (2025) "Structural basis for dual DNA and RNA specificity of the G-quadruplex-resolving DEAH-box helicase DHX36." Cell Rep, 44, 116136. doi: 10.1016/j.celrep.2025.116136. cryo-EM structure of dhx36 bound to the cmyc DNA g-quadruplex, class 2 . 6 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, UUUU, parallel, 4+0, 3(-P-P); UUUU, parallel, 4+0, 3(-P-P-P), coaxial interfaces: 5'/5'
8vx8 motor protein cryo-EM (3.4 Å) Banco MT, Paul T, Jiang J, Myong S, Ferre-D'Amare AR (2025) "Structural basis for dual DNA and RNA specificity of the G-quadruplex-resolving DEAH-box helicase DHX36." Cell Rep, 44, 116136. doi: 10.1016/j.celrep.2025.116136. cryo-EM structure of dhx36 bound to the cmyc DNA g-quadruplex, class 1 . 6 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, UUUU, parallel, 4+0, ; UUUU, parallel, 4+0, 3(-P), coaxial interfaces: 5'/5'
8vxx RNA X-ray (3.1 Å) Yang M, Prestwood PR, Passalacqua LFM, Balaratnam S, Fullenkamp CR, Arney JW, Weeks KM, Ferre-D'Amare A, Schneekloth Jr JS (2025) "Structure-informed design of an ultrabright RNA-activated fluorophore." Nat.Chem., 17, 1188-1195. doi: 10.1038/s41557-025-01832-w. Mango ii bound to 365a-061 . 9 G-tetrads, 2 G4 helices, 3 G4 stems, 1 G4 coaxial stack, UUUU, parallel, 4+0, 3(-P-P-P), coaxial interfaces: 5'/5'
8vxz RNA X-ray (3.0 Å) Yang M, Prestwood PR, Passalacqua LFM, Balaratnam S, Fullenkamp CR, Arney JW, Weeks KM, Ferre-D'Amare A, Schneekloth Jr JS (2025) "Structure-informed design of an ultrabright RNA-activated fluorophore." Nat.Chem., 17, 1188-1195. doi: 10.1038/s41557-025-01832-w. Mango ii bound to 365a-084 . 6 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, UUUU, parallel, 4+0, 3(-P-P-P), coaxial interfaces: 5'/5'
8vy0 RNA X-ray (3.1 Å) Yang M, Prestwood PR, Passalacqua LFM, Balaratnam S, Fullenkamp CR, Arney JW, Weeks KM, Ferre-D'Amare A, Schneekloth Jr JS (2025) "Structure-informed design of an ultrabright RNA-activated fluorophore." Nat.Chem., 17, 1188-1195. doi: 10.1038/s41557-025-01832-w. Mango ii bound to 365a-087 . 9 G-tetrads, 2 G4 helices, 3 G4 stems, 1 G4 coaxial stack, UUUU, parallel, 4+0, 3(-P-P-P), coaxial interfaces: 5'/5'
8vy1 RNA X-ray (3.1 Å) Yang M, Prestwood PR, Passalacqua LFM, Balaratnam S, Fullenkamp CR, Arney JW, Weeks KM, Ferre-D'Amare A, Schneekloth Jr JS (2025) "Structure-informed design of an ultrabright RNA-activated fluorophore." Nat.Chem., 17, 1188-1195. doi: 10.1038/s41557-025-01832-w. Mango ii bound to 365a-088 . 9 G-tetrads, 2 G4 helices, 3 G4 stems, 1 G4 coaxial stack, UUUU, parallel, 4+0, 3(-P-P-P), coaxial interfaces: 5'/5'
8wa4 DNA NMR Xiao CM, Li YP, Liu YS, Dong RF, He XY, Lin Q, Zang X, Wang KB, Xia YZ, Kong LY "Stabilizing ATF4 promoter G-quadruplex overcomes the resistance of glutamine-restricted cancer therapy." Solution structure of free atf4 promoter g-quadruplex . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
8x0s RNA X-ray (2.956 Å) Geng Y, Liu C, Xu N, Suen MC, Miao H, Xie Y, Zhang B, Chen X, Song Y, Wang Z, Cai Q, Zhu G (2024) "Crystal structure of a tetrameric RNA G-quadruplex formed by hexanucleotide repeat expansions of C9orf72 in ALS/FTD." Nucleic Acids Res., 52, 7961-7970. doi: 10.1093/nar/gkae473. Crystal structure of r(g4c2)2 . 8 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, UUUU, parallel, 4+0, coaxial interfaces: 5'/5'
8x1v DNA NMR Wang Y, Wang J, Yan Z, Hou J, Wan L, Yang Y, Liu Y, Yi J, Guo P, Han D (2024) "Structural investigation of pathogenic RFC1 AAGGG pentanucleotide repeats reveals a role of G-quadruplex in dysregulated gene expression in CANVAS." Nucleic Acids Res., 52, 2698-2710. doi: 10.1093/nar/gkae032. NMR structure of a bimolecular parallel g-quadruplex formed by aaggg repeats from pathogenic rfc1 gene . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0
8xak hydrolase-DNA X-ray (3.5 Å) Hong Z, Byrd AK, Gao J, Das P, Tan VQ, Malone EG, Osei B, Marecki JC, Protacio RU, Wahls WP, Raney KD, Song H (2024) "Eukaryotic Pif1 helicase unwinds G-quadruplex and dsDNA using a conserved wedge." Nat Commun, 15, 6104. doi: 10.1038/s41467-024-50575-8. Structure of pif1-g4 complex . 4 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, UUUU, parallel, 4+0, 2(-P-P-P), coaxial interfaces: 3'/5'
8xgp DNA NMR Yan Z, He A, Wan L, Gao Q, Jiang Y, Wang Y, Wang E, Li C, Yang Y, Li Y, Guo P, Han D (2025) "Structural Insights into an Antiparallel Chair-Type G-Quadruplex From the Intron of NOP56 Oncogene." Adv Sci, 12, e2406230. doi: 10.1002/advs.202406230. Solution NMR structure of an antiparallel chair-type g-quadruplex from nop56 intron . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UDUD, anti-parallel:chair, 2+2, 3(-Lw-Ln-Lw)
8y2r DNA NMR Xiao C, Li Y, Liu Y, Dong R, He X, Lin Q, Zang X, Wang K, Xia Y, Kong L (2024) "Overcoming Cancer Persister Cells by Stabilizing the ATF4 Promoter G-quadruplex." Adv Sci, 11, e2401748. doi: 10.1002/advs.202401748. NMR solution structure of the 2:1 coptisine-atf4-g4 complex . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
8yu3 DNA NMR Liu W, Zhu BC, Liu LY, Xia XY, Jang J, Dickerhoff J, Yang D, Mao ZW (2024) "Solution structures and effects of a platinum compound successively bound MYC G-quadruplex." Nucleic Acids Res., 52, 9397-9406. doi: 10.1093/nar/gkae649. NMR solution structure of the 2:1 complex of a platinum(ii) compound bound to myc1234 g-quadruplex . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUDU, hybrid1, 3+1, 3(-P-Lw-Ln)
8zve DNA NMR Tang ZY, Li SR, Bian YT, Chen ZY, Wang YY, Zhang YQ, Li YP, Liu YS, Yang MH, Kong LY, Wang KB "NMR Solution Structure of the Major TMPRSS2 Promoter G-Quadruplex and Its Complex with Berberine." Solution structure of free tmprss2 promoter g-quadruplex . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
8zw3 DNA NMR Tang ZY, Li SR, Bian YT, Chen ZY, Wang YY, Zhang YQ, Li YP, Liu YS, Yang MH, Kong LY, Wang KB "NMR Solution Structure of the Major TMPRSS2 Promoter G-Quadruplex and Its Complex with Berberine." Solution structure of tmprss2 promoter g-quadruplex . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
9b6z DNA NMR Liu W, Zhu BC, Liu LY, Xia XY, Jang J, Dickerhoff J, Yang D, Mao ZW (2024) "Solution structures and effects of a platinum compound successively bound MYC G-quadruplex." Nucleic Acids Res., 52, 9397-9406. doi: 10.1093/nar/gkae649. NMR solution structure of the 1:1 complex of a platinum(ii) compound bound to myc1234 g-quadruplex . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUDU, hybrid1, 3+1, 3(-P-Lw-Ln)
9c46 DNA X-ray (2.39 Å) Seth P, Xing E, Hendrickson AD, Li K, Monsen R, Chaires JB, Neidle S, Yatsunyk LA (2025) "Interaction of N-methylmesoporphyrin IX with a hybrid left-/right-handed G-quadruplex motif from the promoter of the SLC2A1 gene." Nucleic Acids Res., 53. doi: 10.1093/nar/gkae1208. Right-left hybrid parallel g-quadruplex from slc2a1 promoter . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 2(-P-P-P)
9c73 DNA X-ray (1.66 Å) Ali A, Yatsunyk LA "Hybrid G-quadruplex from Tetrahymena thermophila telomeric sequence in complex with triangular star shaped TrisQ ligand." Hybrid g-quadruplex from tetrahymena thermophila telomeric sequence in complex with trisqo . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUDU, hybrid1, 3+1, 3(-P-Lw-Ln)
9cb5 transcription-DNA X-ray (2.6 Å) Chen L, Dickerhoff J, Zheng KW, Erramilli S, Feng H, Wu G, Onel B, Chen Y, Wang KB, Carver M, Lin C, Sakai S, Wan J, Vinson C, Hurley L, Kossiakoff AA, Deng N, Bai Y, Noinaj N, Yang D (2025) "Structural basis for nucleolin recognition of MYC promoter G-quadruplex." Science, 388, eadr1752. doi: 10.1126/science.adr1752. Crystal structure of nucleolin in complex with myc promoter g-quadruplex . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
9ciy DNA X-ray (2.4 Å) Xing ER, Yatsunyk LA "Structure of a left-right-handed G-quadruplex from the promoter of the NSD1 gene." Right-left hybrid parallel g-quadruplex from nsd1 promoter . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 2(-P-P-P)
9dqe DNA NMR Wang YY, Bian YT, Chen XY, Li JZ, Liu YS, Kong LY, Wang KB "BLM G-quadruplex stabilizers synergize with PARP inhibitor to kill BRCA wild-type colon cancer cells." NMR solution structure of the 2:1 coptisine- blm-g4 complex . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
9e2w replication-DNA cryo-EM (3.3 Å) Batra S, Allwein B, Kumar C, Devbhandari S, Bruning JG, Bahng S, Lee CM, Marians KJ, Hite RK, Remus D (2025) "G-quadruplex-stalled eukaryotic replisome structure reveals helical inchworm DNA translocation." Science, 387, eadt1978. doi: 10.1126/science.adt1978. cryo-EM structure of yeast cmg helicase stalled at g4-containing DNA template, state 1 . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
9e2x replication-DNA cryo-EM (3.5 Å) Batra S, Allwein B, Kumar C, Devbhandari S, Bruning JG, Bahng S, Lee CM, Marians KJ, Hite RK, Remus D (2025) "G-quadruplex-stalled eukaryotic replisome structure reveals helical inchworm DNA translocation." Science, 387, eadt1978. doi: 10.1126/science.adt1978. cryo-EM structure of yeast cmg helicase stalled at g4-containing DNA template, state 2 . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
9e2y replication-DNA cryo-EM (3.2 Å) Batra S, Allwein B, Kumar C, Devbhandari S, Bruning JG, Bahng S, Lee CM, Marians KJ, Hite RK, Remus D (2025) "G-quadruplex-stalled eukaryotic replisome structure reveals helical inchworm DNA translocation." Science, 387, eadt1978. doi: 10.1126/science.adt1978. cryo-EM structure of yeast cmg helicase stalled at g4-containing DNA template, state 3 . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
9e2z replication-DNA cryo-EM (2.6 Å) Batra S, Allwein B, Kumar C, Devbhandari S, Bruning JG, Bahng S, Lee CM, Marians KJ, Hite RK, Remus D (2025) "G-quadruplex-stalled eukaryotic replisome structure reveals helical inchworm DNA translocation." Science, 387, eadt1978. doi: 10.1126/science.adt1978. cryo-EM structure of human cmg helicase stalled at g4-containing DNA template . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
9e8e DNA X-ray (1.65 Å) Ali A, Yatsunyk LA "Hybrid G-quadruplex from Tetrahymena thermophila telomeric sequence in complex with triangular star shaped TrisQ ligand." Hybrid g-quadruplex from tetrahymena thermophila telomeric sequence in complex with trisqo form 2 . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUDU, hybrid1, 3+1, 3(-P-Lw-Ln)
9ehb DNA X-ray (2.03 Å) Kuo YA, Chen YI, Siraj N, He Y, Yang Z, Wang Y, Batchelder-Schwab EJ, Korkmaz Z, Yonas S, Nguyen TD, Hong S, Nguyen AT, Kim S, Seifi S, Fan PH, Wu Y, Liu HW, Lu Y, Ren P, Mao C, Yeh HC (2026) "Fluorogenic Aptamer Optimization on a Massively Parallel Sequencing Platform." ACS Sens. doi: 10.1021/acssensors.5c04046. Structure of short lettuce aptamer (c14t variant) bound with to1-biotin. . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
9ehc DNA X-ray (1.5 Å) Kuo YA, Chen YI, Siraj N, He Y, Yang Z, Wang Y, Batchelder-Schwab EJ, Korkmaz Z, Yonas S, Nguyen TD, Hong S, Nguyen AT, Kim S, Seifi S, Fan PH, Wu Y, Liu HW, Lu Y, Ren P, Mao C, Yeh HC (2026) "Fluorogenic Aptamer Optimization on a Massively Parallel Sequencing Platform." ACS Sens. doi: 10.1021/acssensors.5c04046. Structure of short lettuce aptamer bound to to1-3peg-biotin . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
9ehe DNA X-ray (1.63 Å) Kuo YA, Chen YI, Siraj N, He Y, Yang Z, Wang Y, Batchelder-Schwab EJ, Korkmaz Z, Yonas S, Nguyen TD, Hong S, Nguyen AT, Kim S, Seifi S, Fan PH, Wu Y, Liu HW, Lu Y, Ren P, Mao C, Yeh HC (2026) "Fluorogenic Aptamer Optimization on a Massively Parallel Sequencing Platform." ACS Sens. doi: 10.1021/acssensors.5c04046. Structure of short lettuce aptamer (a5t variant) bound with to1-biotin. . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
9eoq DNA cryo-EM (7.5 Å) Khoshouei A, Kempf G, Mykhailiuk V, Griessing JM, Honemann MN, Kater L, Cavadini S, Dietz H (2024) "Designing Rigid DNA Origami Templates for Molecular Visualization Using Cryo-EM." Nano Lett., 24, 5031-5038. doi: 10.1021/acs.nanolett.4c00915. cryo-EM structure of a 1033 scaffold base DNA origami nanostructure v4 and tba . 1 G-tetrad
9fta DNA X-ray (2.49 Å) Sbirkova-Dimitrova HI, Shivachev BL "Crystal structure of d(GGGGTTTTGGGG) with Zn and K." Crystal structure of d(ggggttttgggg) with zn and k . 8 G-tetrads, 2 G4 helices, 2 G4 stems, UDDU, anti-parallel:basket, 2+2
9gvi DNA NMR Ghosh A, Harnos J, Stadlbauer P, Sponer J, Lenarcic Zivkovic M, Trantirek L (2025) "Structural basis of bis-quinolinium ligands binding to quadruplex-duplex hybrids from PIM1 oncogene." Nucleic Acids Res., 53. doi: 10.1093/nar/gkaf894. Quadruplex-duplex hybrids (qdh) complex with phendc3 from pim1 oncogene. . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUDU, hybrid1, 3+1, 3(-P-Lw-Ln)
9gvv DNA NMR Ghosh A, Harnos J, Stadlbauer P, Sponer J, Lenarcic Zivkovic M, Trantirek L (2025) "Structural basis of bis-quinolinium ligands binding to quadruplex-duplex hybrids from PIM1 oncogene." Nucleic Acids Res., 53. doi: 10.1093/nar/gkaf894. Quadruplex-duplex hybrid (qdh) complex with 360a from pim1 oncogene. . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUDU, hybrid1, 3+1, 3(-P-Lw-Ln)
9gxh immune system X-ray (1.9 Å) Pevec M, Medved T, Kovacic M, Zerjav N, Imperl J, Plavec J, Lah J, Loris R, Hadzi S (2025) "Structural basis of G-quadruplex recognition by a camelid antibody fragment." Nucleic Acids Res., 53. doi: 10.1093/nar/gkaf453. Nanobody bound to tba g-quadruplex . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
9hrd RNA X-ray (2.5 Å) Stafflinger H, Neissner K, Bartsch S, Pichler AK, Bartosik K, Dhamotharan K, Abele R, Duchardt-Ferner E, Micura R, Schindelin H, Wohnert J (2025) "Crystal structure of the class V GTP-binding RNA aptamer bound to its ligand: GTP recognition by a topologically complex intermolecular G-quadruplex." Nucleic Acids Res., 53. doi: 10.1093/nar/gkaf1315. Crystal structure of the class v gtp aptamer in complex with gtp . 4 G-tetrads, 2 G4 helices
9hrf RNA X-ray (1.6 Å) Stafflinger H, Neissner K, Bartsch S, Pichler AK, Bartosik K, Dhamotharan K, Abele R, Duchardt-Ferner E, Micura R, Schindelin H, Wohnert J (2025) "Crystal structure of the class V GTP-binding RNA aptamer bound to its ligand: GTP recognition by a topologically complex intermolecular G-quadruplex." Nucleic Acids Res., 53. doi: 10.1093/nar/gkaf1315. Crystal structure of the class v (uu) gtp aptamer variant in complex with gtp . 2 G-tetrads, 1 G4 helix
9hrg RNA X-ray (2.05 Å) Stafflinger H, Neissner K, Bartsch S, Pichler AK, Bartosik K, Dhamotharan K, Abele R, Duchardt-Ferner E, Micura R, Schindelin H, Wohnert J (2025) "Crystal structure of the class V GTP-binding RNA aptamer bound to its ligand: GTP recognition by a topologically complex intermolecular G-quadruplex." Nucleic Acids Res., 53. doi: 10.1093/nar/gkaf1315. Crystal structure of the class v (g61a) gtp aptamer variant in complex with gtp . 4 G-tetrads, 2 G4 helices
9i1p hydrolase X-ray (3.2 Å) Song ZY, Zhang X, Ai X, Huang LY, Hou XM, Fosse P, Liu NN, Mauffret O, Rety S, Xi XG (2025) "Structural mechanism of RECQ1 helicase in unfolding G-quadruplexes compared with duplex DNA." Nucleic Acids Res., 53. doi: 10.1093/nar/gkaf877. Structure of recql- myc g-quadruplex - adp complex from bos taurus . 6 G-tetrads, 2 G4 helices, 2 G4 stems, UUUU, parallel, 4+0, 3(-P-P-P)
9i22 hydrolase X-ray (2.42 Å) Song ZY, Zhang X, Ai X, Huang LY, Hou XM, Fosse P, Liu NN, Mauffret O, Rety S, Xi XG (2025) "Structural mechanism of RECQ1 helicase in unfolding G-quadruplexes compared with duplex DNA." Nucleic Acids Res., 53. doi: 10.1093/nar/gkaf877. Structure of human helicase recq1- myc g-quadruplex - adp complex . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
9i23 hydrolase X-ray (3.69 Å) Song ZY, Zhang X, Ai X, Huang LY, Hou XM, Fosse P, Liu NN, Mauffret O, Rety S, Xi XG (2025) "Structural mechanism of RECQ1 helicase in unfolding G-quadruplexes compared with duplex DNA." Nucleic Acids Res., 53. doi: 10.1093/nar/gkaf877. Structure of human helicase recq1- 795-2t g-quadruplex - adp complex . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
9i5s DNA NMR Avendano Avila C, Heddi B (2025) "An antiparallel G-quadruplex structure with a 5'-end overhang forms predominantly at the human telomeric ds-ss DNA junction." Chem.Commun.(Camb.), 61, 17661-17664. doi: 10.1039/d5cc03633j. Solution structure of an intramolecular anti-parallel g-quadruplex with a 5'-end overhang. . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UDDU, anti-parallel:basket, 2+2, 2(-LwD+Ln)
9imy DNA NMR Hu X, Cao C "Solution structure of MAX G-quadruplex DNA." Solution structure of max1a g-quadruplex DNA . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUD, hybrid2, 3+1, 3(-PD+Lw)
9ji9 DNA NMR Li YP, Zheng Y, Wang YY, Chen XY, Chen RS, Li JZ, Liu YS, Yang MH, Zhang H, Kong LY, Wang KB "Natural alkaloid nitidine stabilizes the major MET promoter G-quadruplex to disrupt its interaction with LRPPRC protein for MET oncogene downregulation." Solution structure of met promoter g-quadruplex . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
9jo0 DNA NMR Wang YY, Bian YT, Chen XY, Li JZ, Liu YS, Kong LY, Wang KB "BLM G-quadruplex stabilizers synergize with PARP inhibitor to kill BRCA wild-type colon cancer cells." Solution structure of free blm promoter g-quadruplex . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
9jo1 DNA NMR Wang YY, Bian YT, Chen XY, Li JZ, Liu YS, Kong LY, Wang KB "BLM G-quadruplex stabilizers synergize with PARP inhibitor to kill BRCA wild-type colon cancer cells." NMR solution structure of the 2:1 berberine-blm-g4 complex . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
9jx5 DNA NMR Yan Z, He A, Wan L, Gao Q, Jiang Y, Wang Y, Wang E, Li C, Yang Y, Li Y, Guo P, Han D (2025) "Structural Insights into an Antiparallel Chair-Type G-Quadruplex From the Intron of NOP56 Oncogene." Adv Sci, 12, e2406230. doi: 10.1002/advs.202406230. Solution NMR structure of the 1:1 complex of nop56 intronic g-quadruplex bound with pyridostatin . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UDUD, anti-parallel:chair, 2+2, 3(-Lw-Ln-Lw)
9k70 DNA-RNA hybrid NMR Fu WQ, Zhang N "Guanine ribonucleotide atypically adaptive to syn glycosidic conformation in an RNA-DNA hybrid G-quadruplex with topologically (3+1) mixed strand orientation." A (3+1) hybrid g-quadruplex assembled between two strands of human telomeric DNA and RNA . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UDUU, hybrid3, 3+1
9kcq DNA binding protein X-ray (1.77 Å) Ngo KH, Heddi B, Winnerdy FR, Phan AT "X-ray structure of a G-quadruplex-ankyrin complex." Crystal structure of an ankyrin protein in complex with g-quadruplex . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UDDU, anti-parallel:basket, 2+2, 3(-LwD+Ln)
9kg4 DNA NMR Zhang YQ, Gu W, He SH, Cheng RS, Chen ZY, Yan TD, Kong LY, Wang KB "G146A Mutation in hTERT Promoter Induces a Distinct G-Quadruplex That Activates hTERT Transcription: Structure Determination and Its Potential as a Drug Target." Solution structure of free htert promoter g-quadruplex . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
9kg8 DNA NMR Zhang YQ, Gu W, He SH, Cheng RS, Chen ZY, Yan TD, Kong LY, Wang KB "G146A Mutation in hTERT Promoter Induces a Distinct G-Quadruplex That Activates hTERT Transcription: Structure Determination and Its Potential as a Drug Target." Solution structure of the 2:1 berberine- htert-g4 complex . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
9l4e DNA NMR Ni X, Hu XD, Long W, Lan W, Wang C, Wong WL, Cao C (2025) "Molecular recognition and effects of a benzothiazole derivative targeting the MYC G-quadruplex." Nucleic Acids Res., 53. doi: 10.1093/nar/gkaf888. Solution structure of the 2:1 complex between the benzothiazole derivative bto-28 and the myc g-quadruplex . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
9mmf DNA X-ray (2.08 Å) Eyiolowope J, Xing ER, Yatsunyk LA "The first crystal structure of five-tetrad G-quadruplex." First structure of five-tetrad g-quadruplex . 10 G-tetrads, 2 G4 helices, 2 G4 stems, UDUU, hybrid3, 3+1, 4(-Lw-Ln-P)
9mxo DNA X-ray (1.68 Å) Hendrickson AD, Xing ER, Yatsunyk LA "Preservation of left-handed fold and interaction with N-methylmesoporphyrin IX by two-block sequences with left-hand folding potential." Motif2-motif1 left-handed parallel g-quadruplex in h3 spacegroup . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 2(+P+P+P), negative twist
9nap RNA cryo-EM (3.01 Å) Jones CP, Ferre-D'Amare AR "Symmetric scaffolds enable de novo modelling of RNA by cryoEM." RNA scaffold attached to mango in the presence of to1-biotin . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UUUD, hybrid2, 3+1, 2(-P-P-Lw)
9o70 DNA X-ray (2.02 Å) Xing ER, Yatsunyk LA "Structure of a left-right-handed G-quadruplex from the promoter of the NSD1 gene." Motif1-motif2, two domain left-handed parallel g-quadruplex . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 2(+P+P+P), negative twist
9p3a DNA X-ray (2.34 Å) Xing ER, Yatsunyk LA "Preservation of left-handed fold and interaction with N-methylmesoporphyrin IX by two-block sequences with left-hand folding potential." T-motif1-motif2 right-left hybrid parallel g-quadruplex in complex with n-methylmesoporphyrin ix . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 2(+P+P+P), negative twist
9pa0 DNA NMR Dickerhoff J, Yang D (2026) "NMR structure study of DNA G-quadruplexes and ligand complexes." Prog.Nucl.Magn.Reson. Spectros., 154-155, 101597. doi: 10.1016/j.pnmrs.2026.101597. Hybrid-1 form of human telomere DNA quadruplex with wild-type 5'-flanking in k+ solution . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUDU, hybrid1, 3+1, 3(-P-Lw-Ln)
9tnq DNA NMR Trajkovski M, Platella C, Musumeci D, Napolitano E, Esposito CL, Catuogno S, Plavec J, Montesarchio D (2026) "Unraveling the NMR structures of G-quadruplex-forming aptamers acting as inhibitors of High Mobility Group Box 1 (HMGB1) pathological activity." Int.J.Biol.Macromol., 357, 151585. doi: 10.1016/j.ijbiomac.2026.151585. L41 g-quadruplex-forming aptamers targeting hmgb1 protein . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UDUU, hybrid3, 3+1, 3(-Lw-Ln-P)
9tnr DNA NMR Trajkovski M, Platella C, Musumeci D, Napolitano E, Esposito CL, Catuogno S, Plavec J, Montesarchio D (2026) "Unraveling the NMR structures of G-quadruplex-forming aptamers acting as inhibitors of High Mobility Group Box 1 (HMGB1) pathological activity." Int.J.Biol.Macromol., 357, 151585. doi: 10.1016/j.ijbiomac.2026.151585. L12 g-quadruplex-forming aptamer targeting hmgb1 protein . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UDUU, hybrid3, 3+1, 3(-Lw-Ln-P)
9u3i DNA X-ray (1.2 Å) Park S, Kanazawa H, Kondo J "Crystal structure of a phenylalanine-modifi ed thrombin-binding DNA aptamer." Crystal structure of a phenylalanine-modifi ed thrombin-binding DNA aptamer . 2 G-tetrads, 1 G4 helix, 1 G4 stem, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
9u83 DNA NMR Negi D, Sannapureddi RKR, Sathyamoorthy B "Molecular Interactions of a Frustrated G-Rich Sequence: Atomistic Insights into Folding of DNA G-Quadruplexes." Structure of aa(gggtt)3gggaa g-quadruplex in the presence of sodium ions . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UDUU, hybrid3, 3+1, 3(-Lw-Ln-P)
9u89 DNA NMR Negi D, Sannapureddi RKR, Sathyamoorthy B "Molecular Interactions of a Frustrated G-Rich Sequence: Atomistic Insights into Folding of DNA G-Quadruplexes." Structure of aa(gggtt)3gggaa g-quadruplex in the presence of potassium ions . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
9uk6 DNA X-ray (1.94 Å) Geng Y, Liu C, Miao H, Suen MC, Xie Y, Zhang B, Han W, Wu C, Ren H, Chen X, Tai HC, Wang Z, Zhu G, Cai Q (2025) "Crystal structures of distinct parallel and antiparallel DNA G-quadruplexes reveal structural polymorphism in C9orf72 G4C2 repeats." Nucleic Acids Res., 53. doi: 10.1093/nar/gkaf879. Dimeric parallel g-quadruplex formed by d(g4c2)4 . 8 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, UUUU, parallel, 4+0, 4(-P-P-P), coaxial interfaces: 5'/5'
9uk8 DNA X-ray (2.7 Å) Geng Y, Liu C, Miao H, Suen MC, Xie Y, Zhang B, Han W, Wu C, Ren H, Chen X, Tai HC, Wang Z, Zhu G, Cai Q (2025) "Crystal structures of distinct parallel and antiparallel DNA G-quadruplexes reveal structural polymorphism in C9orf72 G4C2 repeats." Nucleic Acids Res., 53. doi: 10.1093/nar/gkaf879. Monomeric antiparallel g-quadruplex formed by d(g4c2)4 . 4 G-tetrads, 1 G4 helix, 1 G4 stem, UDUD, anti-parallel:chair, 2+2, 4(+Ln+Lw+Ln)
9va0 DNA NMR Li Y, Ji D, Jia Y, Liang Y, Wei E, Gao C, Li Y, Zeng C, Wang L, Wang C, Guo Z, Zhang Y, Zhou MM, Wu D, Zeng L (2026) "Dual targeting of topoisomerase I and DNA G-quadruplexes enhances senescence and chemosensitivity in colorectal cancer." Commun Biol, 9. doi: 10.1038/s42003-026-09801-w. Solution NMR structures of htert DNA g-quadruplexes (g4s) in complex with small molecule cpt-11 . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
9va3 DNA NMR Li Y, Ji D, Jia Y, Liang Y, Wei E, Gao C, Li Y, Zeng C, Wang L, Wang C, Guo Z, Zhang Y, Zhou MM, Wu D, Zeng L (2026) "Dual targeting of topoisomerase I and DNA G-quadruplexes enhances senescence and chemosensitivity in colorectal cancer." Commun Biol, 9. doi: 10.1038/s42003-026-09801-w. Solution NMR structures of htert DNA g-quadruplexes (g4s) in complex with small molecule zbh-01 . 3 G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
9vmz RNA X-ray (2.44 Å) Peng X, Huang L "Crystal structure of Broccoli aptamer in with BI." Crystal structure of broccoli aptamer in with bi . 4 G-tetrads, 2 G4 helices, 2 G4 stems, UUDD, anti-parallel:basket2, 2+2, 2(-PD+P)
9whv RNA NMR Song SS, Yang L, Wang LW, Tian RQ, Wang SY, Jia MH, Xu Y, Zhong MQ, Liang XG, Hu KL, Luo H, Chen Y, Hu XX, Shen XC, Xiao CD (2026) "An intra-locked RNA G-quadruplex topology confers enhanced nuclease resistance and cancer cell targeting." Int.J.Biol.Macromol., 367, 152564. doi: 10.1016/j.ijbiomac.2026.152564. Cross-stacking-stabilized intra-locked RNA g-quadruplex . 6 G-tetrads, 2 G4 helices, 2 G4 stems, UUUU, parallel, 4+0
pdb-id class method authors reference annotation