|
139d
|
DNA |
NMR |
Wang Y, Patel DJ |
(1993) "Solution
structure of a parallel-stranded G-quadruplex DNA."
J.Mol.Biol., 234, 1171-1183.
doi: 10.1006/jmbi.1993.1668.
|
Solution structure of a parallel-stranded g-quadruplex
DNA . ➥ 4 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0
|
|
143d
|
DNA |
NMR |
Wang Y, Patel DJ |
(1993) "Solution
structure of the human telomeric repeat d[AG3(T2AG3)3]
G-tetraplex." Structure,
1, 263-282. doi: 10.1016/0969-2126(93)90015-9.
|
Solution structure of the human telomeric repeat
d(ag3[t2ag3]3) of the g-quadruplex . ➥ 3
G-tetrads, 1 G4 helix, 1 G4 stem, UDDU,
anti-parallel:basket, 2+2, 3(-LwD+Ln)
|
|
148d
|
DNA |
NMR |
Schultze P, Macaya RF, Feigon J |
(1994) "Three-dimensional
solution structure of the thrombin-binding DNA aptamer
d(GGTTGGTGTGGTTGG)." J.Mol.Biol.,
235, 1532-1547. doi: 10.1006/jmbi.1994.1105.
|
Three-dimensional solution structure of the thrombin
binding DNA aptamer d(ggttggtgtggttgg) . ➥ 2
G-tetrads, 1 G4 helix, 1 G4 stem, UDUD,
anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
|
|
156d
|
DNA |
NMR |
Schultze P, Smith FW, Feigon J |
(1994) "Refined
solution structure of the dimeric quadruplex formed
from the Oxytricha telomeric oligonucleotide
d(GGGGTTTTGGGG)." Structure,
2, 221-233. doi: 10.1016/S0969-2126(00)00023-X.
|
Refined solution structure of the dimeric quadruplex
formed from the oxytricha telomeric oligonucleotide
d(ggggttttgggg) . ➥ 4 G-tetrads, 1 G4 helix, 1 G4
stem, UDDU, anti-parallel:basket, 2+2
|
|
186d
|
DNA |
NMR |
Wang Y, Patel DJ |
(1994) "Solution
structure of the Tetrahymena telomeric repeat d(T2G4)4
G-tetraplex." Structure,
2, 1141-1156. doi: 10.1016/S0969-2126(94)00117-0.
|
Solution structure of the tetrahymena telomeric repeat
d(t2g4)4 g-tetraplex . ➥
3 G-tetrads, 1 G4 helix,
1 G4 stem, UDUU, hybrid3, 3+1, 3(-Lw-Ln-P)
|
|
1a6h
|
DNA |
NMR |
Kettani A, Kumar RA, Patel DJ |
(1995) "Solution
structure of a DNA quadruplex containing the fragile X
syndrome triplet repeat." J.Mol.Biol.,
254, 638-656. doi: 10.1006/jmbi.1995.0644.
|
DNA quadruplex containing gcgc tetrad, NMR, 4
structures . ➥ 4 G-tetrads, 1 G4 helix, 1 G4
stem, UDUD, anti-parallel:chair, 2+2
|
|
1a8n
|
DNA |
NMR |
Kettani A, Bouaziz S, Gorin A, Zhao H, Jones RA,
Patel DJ |
(1998) "Solution
structure of a Na cation stabilized DNA quadruplex
containing G.G.G.G and G.C.G.C tetrads formed by
G-G-G-C repeats observed in adeno-associated viral
DNA." J.Mol.Biol., 282,
619-636. doi: 10.1006/jmbi.1998.2030.
|
Solution structure of a na+ cation stabilized DNA
quadruplex containing g.g.g.g and g.c.g.c tetrads
formed by g-g-g-c repeats observed in aav and human
chromosome 19, NMR, 8 structures . ➥ 2
G-tetrads, 1 G4 helix, 1 G4 stem, UDUD,
anti-parallel:chair, 2+2
|
|
1a8w
|
DNA |
NMR |
Bouaziz S, Kettani A, Patel DJ |
(1998) "A K
cation-induced conformational switch within a loop
spanning segment of a DNA quadruplex containing G-G-G-C
repeats." J.Mol.Biol.,
282, 637-652. doi: 10.1006/jmbi.1998.2031.
|
A k+ cation-induced conformational switch within a loop
spanning segment of a DNA quadruplex containing g-g-g-c
repeats, NMR, 8 structures . ➥
2 G-tetrads, 1 G4 helix,
1 G4 stem, UDUD, anti-parallel:chair, 2+2
|
|
1aff
|
DNA |
NMR |
Kettani A, Bouaziz S, Wang W, Jones RA, Patel DJ |
(1997) "Bombyx
mori single repeat telomeric DNA sequence forms a
G-quadruplex capped by base triads."
Nat.Struct.Biol., 4, 382-389.
doi: 10.1038/nsb0597-382.
|
DNA quadruplex containing gggg tetrads and (t.a).a
triads, NMR, 8 structures . ➥
2 G-tetrads, 1 G4 helix,
1 G4 stem, UUDD, anti-parallel:basket2, 2+2
|
|
1bub
|
DNA |
NMR |
Beger RD, Marathias VM, Volkman BF, Bolton PH |
(1998) "Determination
of internuclear angles of DNA using
paramagnetic-assisted magnetic alignment."
J.Magn.Reson., 135, 256-259.
doi: 10.1006/jmre.1998.1527.
|
Determination of internuclear angles of DNA using
paramagnetic assisted magnetic alignment . ➥ 2
G-tetrads, 1 G4 helix, 1 G4 stem, UDUD,
anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
|
|
1c32
|
DNA |
NMR |
Marathias VM, Bolton PH |
(2000) "Structures
of the potassium-saturated, 2:1, and intermediate, 1:1,
forms of a quadruplex DNA." Nucleic Acids
Res., 28, 1969-1977. doi:
10.1093/nar/28.9.1969.
|
Solution structure of a quadruplex forming DNA and its
intermidiate . ➥ 2 G-tetrads, 1 G4 helix, 1 G4
stem, UDUD, anti-parallel:chair, 2+2, 2(+Lx+Lx+Ln)
|
|
1c34
|
DNA |
NMR |
Marathias VM, Bolton PH |
(2000) "Structures
of the potassium-saturated, 2:1, and intermediate, 1:1,
forms of a quadruplex DNA." Nucleic Acids
Res., 28, 1969-1977. doi:
10.1093/nar/28.9.1969.
|
Solution structure of a quadruplex forming DNA and its
intermidiate . ➥ 2 G-tetrads, 1 G4 helix, 1 G4
stem, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
|
|
1c35
|
DNA |
NMR |
Marathias VM, Bolton PH |
(2000) "Structures
of the potassium-saturated, 2:1, and intermediate, 1:1,
forms of a quadruplex DNA." Nucleic Acids
Res., 28, 1969-1977. doi:
10.1093/nar/28.9.1969.
|
Solution structure of a quadruplex forming DNA and its
intermidiate . ➥ 2 G-tetrads, 1 G4 helix, 1 G4
stem, UDUD, anti-parallel:chair, 2+2, 2(+Lx+Lx+Ln)
|
|
1c38
|
DNA |
NMR |
Marathias VM, Bolton PH |
(2000) "Structures
of the potassium-saturated, 2:1, and intermediate, 1:1,
forms of a quadruplex DNA." Nucleic Acids
Res., 28, 1969-1977. doi:
10.1093/nar/28.9.1969.
|
Solution structure of a quadruplex forming DNA and its
intermediate . ➥ 2 G-tetrads, 1 G4 helix, 1 G4
stem, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
|
|
1d59
|
DNA |
X-ray (2.3 Å) |
Kang C, Zhang X, Ratliff R, Moyzis R, Rich A |
(1992) "Crystal
structure of four-stranded Oxytricha telomeric
DNA." Nature, 356,
126-131. doi: 10.1038/356126a0.
|
Crystal structure of 4-stranded oxytricha telomeric DNA
. ➥ 4 G-tetrads, 1 G4 helix, 1 G4
stem, UDUD, anti-parallel:chair, 2+2
|
|
1d6d
|
DNA |
NMR |
Kuryavyi V, Kettani A, Wang W, Jones R, Patel DJ |
(2000) "A
diamond-shaped zipper-like DNA architecture containing
triads sandwiched between mismatches and tetrads."
J.Mol.Biol., 295, 455-469.
doi: 10.1006/jmbi.1999.3345.
|
Solution DNA structure containing (a-a)-t triads
interdigitated between a-t base pairs and gggg tetrads;
NMR, 8 struct. . ➥ 2 G-tetrads, 1 G4 helix, 1 G4
stem, UUDD, anti-parallel:basket2, 2+2
|
|
1eeg
|
DNA |
NMR |
Kettani A, Gorin A, Majumdar A, Hermann T, Skripkin
E, Zhao H, Jones R, Patel DJ |
(2000) "A
dimeric DNA interface stabilized by stacked
A.(G.G.G.G).A hexads and coordinated monovalent
cations." J.Mol.Biol.,
297, 627-644. doi: 10.1006/jmbi.2000.3524.
|
A(gggg)a hexad pairing aligment for the
d(g-g-a-g-g-a-g) sequence . ➥
4 G-tetrads, 1 G4 helix,
2 G4 stems, 1 G4 coaxial stack, UUUU, parallel, 4+0,
coaxial interfaces: 5'/5'
|
|
1emq
|
DNA |
NMR |
Patel PK, Hosur RV |
(1999) "NMR
observation of T-tetrads in a parallel stranded DNA
quadruplex formed by Saccharomyces cerevisiae telomere
repeats." Nucleic Acids Res.,
27, 2457-2464. doi: 10.1093/nar/27.12.2457.
|
NMR observation of t-tetrads in a parallel stranded DNA
quadruplex formed by saccharomyces cerevisiae telomere
repeats . ➥ 4 G-tetrads, 1 G4 helix, 2 G4
stems, 1 G4 coaxial stack, UUUU, parallel, 4+0, coaxial
interfaces: 3'/5'
|
|
1evm
|
DNA |
NMR |
Patel PK, Koti AS, Hosur RV |
(1999) "NMR
studies on truncated sequences of human telomeric DNA:
observation of a novel A-tetrad." Nucleic Acids
Res., 27, 3836-3843. doi:
10.1093/nar/27.19.3836.
|
NMR observation of a-tetrad . ➥ 3
G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel,
4+0
|
|
1evn
|
DNA |
NMR |
Patel PK, Koti AS, Hosur RV |
(1999) "NMR
studies on truncated sequences of human telomeric DNA:
observation of a novel A-tetrad." Nucleic Acids
Res., 27, 3836-3843. doi:
10.1093/nar/27.19.3836.
|
NMR observation of a-tetrad . ➥ 3
G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel,
4+0
|
|
1evo
|
DNA |
NMR |
Patel PK, Bhavesh NS, Hosur RV |
(2000) "NMR
observation of a novel C-tetrad in the structure of the
SV40 repeat sequence GGGCGG."
Biochem.Biophys.Res.Commun.,
270, 967-971. doi: 10.1006/bbrc.2000.2479.
|
NMR observation of a novel c-tetrad . ➥ 5
G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack,
UUUU, parallel, 4+0, coaxial interfaces: 3'/5'
|
|
1f3s
|
DNA |
NMR |
Kettani A, Basu G, Gorin A, Majumdar A, Skripkin E,
Patel DJ |
(2000) "A
two-stranded template-based approach to G.(C-A) triad
formation: designing novel structural elements into an
existing DNA framework." J.Mol.Biol.,
301, 129-146. doi: 10.1006/jmbi.2000.3932.
|
Solution structure of DNA sequence gggttcagg forms gggg
tetrade and g(c-a) triad. . ➥
2 G-tetrads, 1 G4 helix,
1 G4 stem, UDUD, anti-parallel:chair, 2+2
|
|
1fqp
|
DNA |
NMR |
Keniry MA, Strahan GD, Owen EA, Shafer RH |
(1995) "Solution
structure of the Na+ form of the dimeric guanine
quadruplex [d(G3T4G3)]2." Eur.J.Biochem.,
233, 631-643. doi: 10.1111/j.1432-1033.1995.631_2.x.
|
Intramolecular quadruplex DNA with three gggg repeats,
NMR, ph 6.7, 0.1 m na+ and 4 mm (strand concentration),
5 structures . ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UDDU, anti-parallel:basket, 2+2
|
|
1hao
|
hydrolase-hydrolase inhibitor-DNA |
X-ray (2.8 Å) |
Padmanabhan K, Tulinsky A |
(1996) "An
ambiguous structure of a DNA 15-mer thrombin
complex." Acta Crystallogr.,Sect.D,
52, 272-282. doi: 10.1107/S0907444995013977.
|
Complex of human alpha-thrombin with a 15mer
oligonucleotide ggttggtgtggttgg (based on NMR model of
DNA) . ➥ 2 G-tetrads, 1 G4 helix, 1 G4
stem, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
|
|
1hap
|
hydrolase-hydrolase inhibitor-DNA |
X-ray (2.8 Å) |
Padmanabhan K, Tulinsky A |
(1996) "An
ambiguous structure of a DNA 15-mer thrombin
complex." Acta Crystallogr.,Sect.D,
52, 272-282. doi: 10.1107/S0907444995013977.
|
Complex of human alpha-thrombin with a 15mer
oligonucleotide ggttggtgtggttgg (based on x-ray model
of DNA) . ➥ 2 G-tetrads, 1 G4 helix, 1 G4
stem, UDUD, anti-parallel:chair, 2+2, 2(-Lw-Ln-Lw)
|
|
1hut
|
hydrolase-hydrolase inhibitor-DNA |
X-ray (2.9 Å) |
Padmanabhan K, Padmanabhan KP, Ferrara JD, Sadler JE,
Tulinsky A |
(1993) "The
structure of alpha-thrombin inhibited by a 15-mer
single-stranded DNA aptamer."
J.Biol.Chem., 268,
17651-17654.
|
The structure of alpha-thrombin inhibited by a 15-mer
single-stranded DNA aptamer . ➥ 2
G-tetrads, 1 G4 helix, 1 G4 stem, UDUD,
anti-parallel:chair, 2+2, 2(-Lw-Ln-Lw)
|
|
1i34
|
DNA |
NMR |
Kuryavyi V, Majumdar A, Shallop A, Chernichenko N,
Skripkin E, Jones R, Patel DJ |
(2001) "A double
chain reversal loop and two diagonal loops define the
architecture of a unimolecular DNA quadruplex
containing a pair of stacked
G(syn)-G(syn)-G(anti)-G(anti) tetrads flanked by a
G-(T-T) Triad and a T-T-T triple."
J.Mol.Biol., 310, 181-194.
doi: 10.1006/jmbi.2001.4759.
|
Solution DNA quadruplex with double chain reversal loop
and two diagonal loops connecting gggg tetrads flanked
by g-(t-t) triad and t-t-t triple . ➥ 2
G-tetrads, 1 G4 helix, 1 G4 stem, UDDU,
anti-parallel:basket, 2+2, 2(D+PD)
|
|
1j6s
|
RNA |
X-ray (1.4 Å) |
Pan B, Xiong Y, Shi K, Deng J, Sundaralingam M |
(2003) "Crystal
structure of an RNA purine-rich tetraplex containing
adenine tetrads: implications for specific binding in
RNA tetraplexes." Structure,
11, 815-823. doi: 10.1016/S0969-2126(03)00107-2.
|
Crystal structure of an RNA tetraplex (ugaggu)4 with
a-tetrads, g-tetrads, u-tetrads and g-u octads .
➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0
|
|
1j8g
|
RNA |
X-ray (0.61 Å) |
Deng J, Xiong Y, Sundaralingam M |
(2001) "X-ray
analysis of an RNA tetraplex (UGGGGU)(4) with divalent
Sr(2+) ions at subatomic resolution (0.61 A)."
Proc.Natl.Acad.Sci.USA, 98,
13665-13670. doi: 10.1073/pnas.241374798.
|
X-ray analysis of a RNA tetraplex r(uggggu)4 at
ultra-high resolution . ➥
4 G-tetrads, 1 G4 helix,
1 G4 stem, UUUU, parallel, 4+0
|
|
1jb7
|
DNA-binding protein-DNA |
X-ray (1.86 Å) |
Horvath MP, Schultz SC |
(2001) "DNA
G-quartets in a 1.86 A resolution structure of an
Oxytricha nova telomeric protein-DNA complex."
J.Mol.Biol., 310, 367-377.
doi: 10.1006/jmbi.2001.4766.
|
DNA g-quartets in a 1.86 Å resolution structure of an
oxytricha nova telomeric protein-DNA complex .
➥ 4 G-tetrads, 1 G4 helix, 1 G4
stem, UDDU, anti-parallel:basket, 2+2
|
|
1jjp
|
DNA |
NMR |
Zhang N, Gorin A, Majumdar A, Kettani A, Chernichenko
N, Skripkin E, Patel DJ |
(2001) "V-shaped
scaffold: a new architectural motif identified in an A
x (G x G x G x G) pentad-containing dimeric DNA
quadruplex involving stacked G(anti) x G(anti) x
G(anti) x G(syn) tetrads." J.Mol.Biol.,
311, 1063-1079. doi: 10.1006/jmbi.2001.4916.
|
A(gggg) pentad-containing dimeric DNA quadruplex
involving stacked g(anti)g(anti)g(anti)g(syn) tetrads .
➥ 4 G-tetrads, 1 G4 helix
|
|
1jpq
|
DNA |
X-ray (1.6 Å) |
Haider S, Parkinson GN, Neidle S |
(2002) "Crystal
structure of the potassium form of an Oxytricha nova
G-quadruplex." J.Mol.Biol.,
320, 189-200. doi: 10.1016/S0022-2836(02)00428-X.
|
Crystal structure of the oxytricha telomeric DNA at
1.6a . ➥ 4 G-tetrads, 1 G4 helix, 1 G4
stem, UDDU, anti-parallel:basket, 2+2
|
|
1jrn
|
DNA |
X-ray (2.0 Å) |
Haider S, Parkinson GN, Neidle S |
(2002) "Crystal
structure of the potassium form of an Oxytricha nova
G-quadruplex." J.Mol.Biol.,
320, 189-200. doi: 10.1016/S0022-2836(02)00428-X.
|
Orthorhombic form of oxytricha telomeric DNA at 2.0a .
➥ 4 G-tetrads, 1 G4 helix, 1 G4
stem, UDDU, anti-parallel:basket, 2+2
|
|
1jvc
|
DNA |
NMR |
Zhang N, Gorin A, Majumdar A, Kettani A, Chernichenko
N, Skripkin E, Patel DJ |
(2001) "Dimeric
DNA quadruplex containing major groove-aligned A-T-A-T
and G-C-G-C tetrads stabilized by inter-subunit
Watson-Crick A-T and G-C pairs."
J.Mol.Biol., 312, 1073-1088.
doi: 10.1006/jmbi.2001.5002.
|
Dimeric DNA quadruplex containing major groove-aligned
a.t.a.t and g.c.g.c tetrads stabilized by inter-subunit
watson-crick a:t and g:c pairs . ➥ 1
G-tetrad
|
|
1k4x
|
DNA |
NMR |
Schultze P, Hud NV, Smith FW, Feigon J |
(1999) "The
effect of sodium, potassium and ammonium ions on the
conformation of the dimeric quadruplex formed by the
Oxytricha nova telomere repeat oligonucleotide
d(G(4)T(4)G(4))." Nucleic Acids Res.,
27, 3018-3028. doi: 10.1093/nar/27.15.3018.
|
Potassium form of oxy-1.5 quadruplex DNA . ➥ 4
G-tetrads, 1 G4 helix, 1 G4 stem, UDDU,
anti-parallel:basket, 2+2
|
|
1k8p
|
DNA |
X-ray (2.4 Å) |
Parkinson GN, Lee MP, Neidle S |
(2002) "Crystal
structure of parallel quadruplexes from human telomeric
DNA." Nature, 417,
876-880. doi: 10.1038/nature755.
|
Structure of the human g-quadruplex reveals a novel
topology . ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0
|
|
1kf1
|
DNA |
X-ray (2.1 Å) |
Parkinson GN, Lee MP, Neidle S |
(2002) "Crystal
structure of parallel quadruplexes from human telomeric
DNA." Nature, 417,
876-880. doi: 10.1038/nature755.
|
Structure and packing of human telomeric DNA .
➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
1l1h
|
DNA |
X-ray (1.75 Å) |
Haider SM, Parkinson GN, Neidle S |
(2003) "Structure
of a G-quadruplex-Ligand Complex."
J.Mol.Biol., 326, 117-125.
doi: 10.1016/S0022-2836(02)01354-2.
|
Crystal structure of the quadruplex DNA-drug complex .
➥ 4 G-tetrads, 1 G4 helix, 1 G4
stem, UDDU, anti-parallel:basket, 2+2
|
|
1lvs
|
DNA |
NMR |
Crnugelj M, Hud NV, Plavec J |
(2002) "The
solution structure of d(G(4)T(4)G(3))(2): a bimolecular
G-quadruplex with a novel fold."
J.Mol.Biol., 320, 911-924.
doi: 10.1016/S0022-2836(02)00569-7.
|
The solution structure of d(g4t4g3)2 . ➥ 3
G-tetrads, 1 G4 helix, 1 G4 stem, UDDU,
anti-parallel:basket, 2+2
|
|
1mdg
|
RNA |
X-ray (1.5 Å) |
Pan BC, Xiong Y, Shi K, Sundaralingam M |
(2003) "An
Eight-Stranded Helical Fragment in RNA Crystal
Structure: Implications for Tetraplex Interaction."
Structure, 11, 825-831. doi:
10.1016/S0969-2126(03)00108-4.
|
An alternating antiparallel octaplex in an RNA crystal
structure . ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0
|
|
1my9
|
RNA |
NMR |
Liu H, Matsugami A, Katahira M, Uesugi S |
(2002) "A
Dimeric RNA Quadruplex Architecture Comprised of Two
G:G(:A):G:G(:A) Hexads, G:G:G:G Tetrads and UUUU
Loops." J.Mol.Biol., 322,
955-970. doi: 10.1016/S0022-2836(02)00876-8.
|
Solution structure of a k+ cation stabilized dimeric
RNA quadruplex containing two g:g(:a):g:g(:a) hexads,
g:g:g:g tetrads and uuuu loops . ➥ 4
G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack,
UUUU, parallel, 4+0, 2(-P-P-P), coaxial interfaces:
5'/5'
|
|
1myq
|
DNA |
NMR |
Matsugami A, Ouhashi K, Kanagawa M, Liu H, Kanagawa
S, Uesugi S, Katahira M |
(2001) "An
intramolecular quadruplex of (GGA)(4) triplet repeat
DNA with a G:G:G:G tetrad and a G(:A):G(:A):G(:A):G
heptad, and its dimeric interaction."
J.Mol.Biol., 313, 255-269.
doi: 10.1006/jmbi.2001.5047.
|
An intramolecular quadruplex of (gga)(4) triplet repeat
DNA with a g:g:g:g tetrad and a g(:a):g(:a):g(:a):g
heptad, and its dimeric interaction . ➥ 4
G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack,
UUUU, parallel, 4+0, 2(-P-P-P), coaxial interfaces:
5'/5'
|
|
1n7a
|
DNA, RNA |
X-ray (1.2 Å) |
Ravelli RBG, Leiros H-KS, Pan B, Caffrey M, McSweeney
S |
(2003) "Specific
Radiation-Damage Can Be Used To Solve Macromolecular
Crystal Structures." Structure,
11, 217-224. doi: 10.1016/S0969-2126(03)00006-6.
|
Rip-radiation-damage induced phasing . ➥ 6
G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack,
UUUU, parallel, 4+0, coaxial interfaces:
5'/5'-SEPARATED
|
|
1n7b
|
DNA, RNA |
X-ray (1.4 Å) |
Ravelli RBG, Leiros H-KS, Pan B, Caffrey M, McSweeney
S |
(2003) "Specific
Radiation-Damage Can Be Used To Solve Macromolecular
Crystal Structures." Structure,
11, 217-224. doi: 10.1016/S0969-2126(03)00006-6.
|
Rip-radiation-damage induced phasing . ➥ 6
G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack,
UUUU, parallel, 4+0, coaxial interfaces:
5'/5'-SEPARATED
|
|
1np9
|
DNA |
NMR |
Gavathiotis E, Searle MS |
(2003) "Structure
of the parallel-stranded DNA quadruplex d(TTAGGGT)4
containing the human telomeric repeat: evidence for
A-tetrad formation from NMR and molecular dynamics
simulations." ORG.BIOMOL.CHEM.,
1, 1650-1656. doi: 10.1039/b300845m.
|
Structure of the parallel-stranded DNA quadruplex
d(ttaggga)4 containing the human telomeric repeat .
➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0
|
|
1nyd
|
DNA |
NMR |
Webba da Silva M |
(2003) "Association
of DNA quadruplexes through G:C:G:C tetrads. Solution
structure of d(GCGGTGGAT)." Biochemistry,
42, 14356-14365. doi: 10.1021/bi0355185.
|
Solution structure of DNA quadruplex gcggtggat .
➥ 4 G-tetrads, 2 G4 helices, 2 G4
stems, UUUU, parallel, 4+0
|
|
1nzm
|
DNA |
NMR |
Gavathiotis E, Heald RA, Stevens MFG, Searle MS |
(2003) "Drug
Recognition and Stabilisation of the Parallel-stranded
DNA Quadruplex d(TTAGGGT)4 Containing the Human
Telomeric Repeat." J.Mol.Biol.,
334, 25-36. doi: 10.1016/j.jmb.2003.09.018.
|
NMR structure of the parallel-stranded DNA quadruplex
d(ttagggt)4 complexed with the telomerase inhibitor
rhps4 . ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0
|
|
1o0k
|
DNA |
X-ray (1.17 Å) |
Clark GR, Pytel PD, Squire CJ, Neidle S |
(2003) "Structure
of the First Parallel DNA Quadruplex-drug Complex."
J.Am.Chem.Soc., 125,
4066-4067. doi: 10.1021/ja0297988.
|
Structure of the first parallel DNA quadruplex-drug
complex . ➥ 8 G-tetrads, 2 G4 helices, 2 G4
stems, UUUU, parallel, 4+0
|
|
1oz8
|
DNA |
NMR |
Matsugami A, Okuizumi T, Uesugi S, Katahira M |
(2003) "Intramolecular
Higher Order Packing of Parallel Quadruplexes
Comprising a G:G:G:G Tetrad and a G(:A):G(:A):G(:A):G
Heptad of GGA Triplet Repeat DNA."
J.BIOL.CHEM., 278,
28147-28153. doi: 10.1074/jbc.M303694200.
|
Intramolecular higher-order packing of parallel
quadruplexes comprising a g:g:g:g tetrad and a
g(:a):g(:a):g(:a):g heptad of gga triplet repeat DNA .
➥ 4 G-tetrads, 1 G4 helix, 2 G4
stems, 1 G4 coaxial stack, UUUU, parallel, 4+0,
2(-P-P-P), coaxial interfaces: 5'/5'
|
|
1pa6
|
DNA binding protein-DNA |
X-ray (2.45 Å) |
Theobald DL, Schultz SC |
(2003) "Nucleotide
shuffling and ssDNA recognition in Oxytricha nova
telomere end-binding protein complexes." Embo
J., 22, 4314-4324. doi: 10.1093/emboj/cdg415.
|
Crystal structure of the oxytricha nova telomere
end-binding protein complexed with noncognate ssDNA
ggggttttgagg . ➥ 4 G-tetrads, 1 G4 helix, 1 G4
stem, UDDU, anti-parallel:basket, 2+2
|
|
1ph1
|
DNA binding protein-DNA |
X-ray (2.51 Å) |
Theobald DL, Schultz SC |
(2003) "Nucleotide
Shuffling and Ssdna Recognition in Oxytricha Nova
Telomere End-Binding Protein Complexes." Embo
J., 22, 4314-4324. doi: 10.1093/emboj/cdg415.
|
Crystal structure of the oxytricha nova telomere
end-binding protein complexed with noncognate ssDNA
ggggttttggggt . ➥ 4 G-tetrads, 1 G4 helix, 1 G4
stem, UDDU, anti-parallel:basket, 2+2
|
|
1ph2
|
DNA binding protein-DNA |
X-ray (3.1 Å) |
Theobald DL, Schultz SC |
(2003) "Nucleotide
Shuffling and ssDNA Recognition in Oxytricha Nova
Telomere End-Binding Protein Complexes." Embo
J., 22, 4314-4324. doi: 10.1093/emboj/cdg415.
|
Crystal structure of the oxytricha nova telomere
end-binding protein complexed with noncognate ssDNA
ggggttttg . ➥ 4 G-tetrads, 1 G4 helix, 1 G4
stem, UDDU, anti-parallel:basket, 2+2
|
|
1ph3
|
DNA binding protein-DNA |
X-ray (2.3 Å) |
Theobald DL, Schultz SC |
(2003) "Nucleotide
Shuffling and ssDNA Recognition in Oxytricha Nova
Telomere End-Binding Protein Complexes." Embo
J., 22, 4314-4324. doi: 10.1093/emboj/cdg415.
|
Crystal structure of the oxytricha nova telomere
end-binding protein complexed with noncognate ssDNA
ggggttttggtg . ➥ 4 G-tetrads, 1 G4 helix, 1 G4
stem, UDDU, anti-parallel:basket, 2+2
|
|
1ph4
|
DNA binding protein-DNA |
X-ray (2.3 Å) |
Theobald DL, Schultz SC |
(2003) "Nucleotide
Shuffling and ssDNA Recognition in Oxytricha Nova
Telomere End-Binding Protein Complexes." Embo
J., 22, 4314-4324. doi: 10.1093/emboj/cdg415.
|
Crystal structure of the oxytricha nova telomere
end-binding protein complexed with noncognate ssDNA
ggggttttggcg . ➥ 4 G-tetrads, 1 G4 helix, 1 G4
stem, UDDU, anti-parallel:basket, 2+2
|
|
1ph5
|
DNA binding protein-DNA |
X-ray (2.3 Å) |
Theobald DL, Schultz SC |
(2003) "Nucleotide
Shuffling and ssDNA Recognition in Oxytricha Nova
Telomere End-Binding Protein Complexes." Embo
J., 22, 4314-4324. doi: 10.1093/emboj/cdg415.
|
Crystal structure of the oxytricha nova telomere
end-binding protein complexed with noncognate ssDNA
ggggttttg(3dr)gg . ➥ 4 G-tetrads, 1 G4 helix, 1 G4
stem, UDDU, anti-parallel:basket, 2+2
|
|
1ph6
|
DNA binding protein-DNA |
X-ray (2.1 Å) |
Theobald DL, Schultz SC |
(2003) "Nucleotide
Shuffling and ssDNA Recognition in Oxytricha Nova
Telomere End-Binding Protein Complexes." Embo
J., 22, 4314-4324. doi: 10.1093/emboj/cdg415.
|
Crystal structure of the oxytricha nova telomere
end-binding protein complexed with noncognate ssDNA
ggggttttgtgg . ➥ 4 G-tetrads, 1 G4 helix, 1 G4
stem, UDDU, anti-parallel:basket, 2+2
|
|
1ph7
|
DNA binding protein-DNA |
X-ray (2.9 Å) |
Theobald DL, Schultz SC |
(2003) "Nucleotide
Shuffling and ssDNA Recognition in Oxytricha Nova
Telomere End-Binding Protein Complexes." Embo
J., 22, 4314-4324. doi: 10.1093/emboj/cdg415.
|
Crystal structure of the oxytricha nova telomere
end-binding protein complexed with noncognate ssDNA
ggggttttgigg . ➥ 4 G-tetrads, 1 G4 helix, 1 G4
stem, UDDU, anti-parallel:basket, 2+2
|
|
1ph8
|
DNA binding protein-DNA |
X-ray (2.36 Å) |
Theobald DL, Schultz SC |
(2003) "Nucleotide
Shuffling and Ssdna Recognition in Oxytricha Nova
Telomere End-Binding Protein Complexes." Embo
J., 22, 4314-4324. doi: 10.1093/emboj/cdg415.
|
Crystal structure of the oxytricha nova telomere
end-binding protein complexed with noncognate ssDNA
ggggttttgcgg . ➥ 4 G-tetrads, 1 G4 helix, 1 G4
stem, UDDU, anti-parallel:basket, 2+2
|
|
1ph9
|
DNA binding protein-DNA |
X-ray (2.5 Å) |
Theobald DL, Schultz SC |
(2003) "Nucleotide
Shuffling and ssDNA Recognition in Oxytricha Nova
Telomere End-Binding Protein Complexes." Embo
J., 22, 4314-4324. doi: 10.1093/emboj/cdg415.
|
Crystal structure of the oxytricha nova telomere
end-binding protein complexed with noncognate ssDNA
ggggttttgagg . ➥ 4 G-tetrads, 1 G4 helix, 1 G4
stem, UDDU, anti-parallel:basket, 2+2
|
|
1phj
|
DNA binding protein-DNA |
X-ray (2.5 Å) |
Theobald DL, Schultz SC |
(2003) "Nucleotide
Shuffling and ssDNA Recognition in Oxytricha Nova
Telomere End-Binding Protein Complexes." Embo
J., 22, 4314-4324. doi: 10.1093/emboj/cdg415.
|
Crystal structure of the oxytricha nova telomere
end-binding protein complexed with noncognate ssDNA
gg(3dr)gttttgggg . ➥ 4 G-tetrads, 1 G4 helix, 1 G4
stem, UDDU, anti-parallel:basket, 2+2
|
|
1qdf
|
DNA |
NMR |
Marathias VM, Wang KY, Kumar S, Pham TQ, Swaminathan
S, Bolton PH |
(1996) "Determination
of the number and location of the manganese binding
sites of DNA quadruplexes in solution by EPR and NMR in
the presence and absence of thrombin."
J.Mol.Biol., 260, 378-394.
doi: 10.1006/jmbi.1996.0408.
|
The NMR study of DNA quadruplex structure, aptamer
(15mer) DNA . ➥ 2 G-tetrads, 1 G4 helix, 1 G4
stem, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
|
|
1qdh
|
DNA |
NMR |
Marathias VM, Wang KY, Kumar S, Pham TQ, Swaminathan
S, Bolton PH |
(1996) "Determination
of the number and location of the manganese binding
sites of DNA quadruplexes in solution by EPR and NMR in
the presence and absence of thrombin."
J.Mol.Biol., 260, 378-394.
doi: 10.1006/jmbi.1996.0408.
|
The NMR study of DNA quadruplex structure, aptamer
(15mer) DNA . ➥ 2 G-tetrads, 1 G4 helix, 1 G4
stem, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
|
|
1qdi
|
DNA |
NMR |
Marathias VM, Wang KY, Kumar S, Pham TQ, Swaminathan
S, Bolton PH |
(1996) "Determination
of the number and location of the manganese binding
sites of DNA quadruplexes in solution by EPR and NMR in
the presence and absence of thrombin."
J.Mol.Biol., 260, 378-394.
doi: 10.1006/jmbi.1996.0408.
|
The NMR study of DNA quadruplex structure, (12mer) DNA
. ➥ 4 G-tetrads, 1 G4 helix, 1 G4
stem, UDDU, anti-parallel:basket, 2+2
|
|
1qdk
|
DNA |
NMR |
Marathias VM, Wang KY, Kumar S, Pham TQ, Swaminathan
S, Bolton PH |
(1996) "Determination
of the number and location of the manganese binding
sites of DNA quadruplexes in solution by EPR and NMR in
the presence and absence of thrombin."
J.Mol.Biol., 260, 378-394.
doi: 10.1006/jmbi.1996.0408.
|
The NMR study of DNA quadruplex structure, (12mer) DNA
. ➥ 4 G-tetrads, 1 G4 helix, 1 G4
stem, UDDU, anti-parallel:basket, 2+2
|
|
1rau
|
RNA |
NMR |
Cheong C, Moore PB |
(1992) "Solution
structure of an unusually stable RNA tetraplex
containing G- and U-quartet structures."
Biochemistry, 31, 8406-8414.
doi: 10.1021/bi00151a003.
|
Solution structure of an unusually stable RNA tetraplex
containing g-and u-quartet structures . ➥ 4
G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel,
4+0
|
|
1rde
|
DNA |
NMR |
Mao X, Marky LA, Gmeiner WH |
(2004) "NMR
structure of the thrombin-binding DNA aptamer
stabilized by Sr2+." J.Biomol.Struct.Dyn.,
22, 25-33.
|
NMR structure of the thrombin-binding DNA aptamer
stabilized by sr2+ . ➥
2 G-tetrads, 1 G4 helix,
1 G4 stem, UDUD, anti-parallel:chair, 2+2,
2(+Ln+Lw+Ln)
|
|
1s45
|
DNA |
X-ray (2.2 Å) |
Caceres C, Wright G, Gouyette C, Parkinson G,
Subirana JA |
(2004) "A
Thymine tetrad in d(TGGGGT) quadruplexes stabilized
with Tl+1/Na+1 ions." Nucleic Acids Res.,
32, 1097-1102. doi: 10.1093/nar/gkh269.
|
Crystal structure analysis of the DNA quadruplex
d(tggggt) s1 . ➥ 4 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0
|
|
1s47
|
DNA |
X-ray (2.5 Å) |
Caceres C, Wright G, Gouyette C, Parkinson G,
Subirana JA |
(2004) "A
Thymine tetrad in d(TGGGGT) quadruplexes stabilized
with Tl+1/Na+1 ions." Nucleic Acids Res.,
32, 1097-1102. doi: 10.1093/nar/gkh269.
|
Crystal structure analysis of the DNA quadruplex
d(tggggt)s2 . ➥ 4 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0
|
|
1s9l
|
RNA |
NMR |
Randazzo A, Esposito V, Ohlenschlager O, Ramachandran
R, Mayola L |
(2004) "NMR
solution structure of a parallel LNA quadruplex."
Nucleic Acids Res., 32,
3083-3092. doi: 10.1093/nar/gkh629.
|
NMR solution structure of a parallel lna quadruplex .
➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0
|
|
1u64
|
DNA |
NMR |
Sket P, Crnugelj M, Plavec J |
(2004) "d(G3T4G4)
forms unusual dimeric G-quadruplex structure with the
same general fold in the presence of K+, Na+ or NH4+
ions." Bioorg.Med.Chem.,
12, 5735-5744. doi: 10.1016/j.bmc.2004.08.009.
|
The solution structure of d(g3t4g4)2 . ➥ 3
G-tetrads, 1 G4 helix, 1 G4 stem, UDDD, hybrid4,
1+3
|
|
1v3p
|
DNA |
X-ray (2.3 Å) |
Kondo J, Adachi W, Umeda S, Sunami T, Takenaka A |
(2004) "Crystal
structures of a DNA octaplex with I-motif of G-quartets
and its splitting into two quadruplexes suggest a
folding mechanism of eight tandem repeats."
Nucleic Acids Res., 32,
2541-2549. doi: 10.1093/nar/gkh575.
|
Crystal structure of d(gcgagagc): the DNA octaplex
structure with i-motif of g-quartet . ➥ 2
G-tetrads, 1 G4 helix
|
|
1xav
|
DNA |
NMR |
Ambrus A, Chen D, Dai J, Jones RA, Yang D |
(2005) "Solution
structure of the biologically relevant G-Quadruplex
element in the human c-MYC promoter. Implications for
G-quadruplex stabilization." Biochemistry,
44, 2048-2058. doi: 10.1021/bi048242p.
|
Major g-quadruplex structure formed in human c-myc
promoter, a monomeric parallel-stranded quadruplex .
➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
1xce
|
DNA |
NMR |
Webba da Silva M |
(2005) "Experimental
Demonstration of T:(G:G:G):T Hexad and T:A:A:T Tetrad
Alignments within a DNA Quadruplex Stem."
Biochemistry, 44, 3754-3764.
doi: 10.1021/bi0478190.
|
Helica structure of DNA by design: the t(gggg)t hexad
alignment . ➥ 4 G-tetrads, 2 G4 helices, 2 G4
stems, UUUU, parallel, 4+0
|
|
1y8d
|
DNA |
NMR |
Phan AT, Kuryavyi VV, Ma J-B, Faure A, Andreola M-L,
Patel DJ |
(2005) "An
interlocked dimeric parallel-stranded DNA quadruplex: A
potent inhibitor of HIV-1 integrase."
Proc.Natl.Acad.Sci.USA, 102,
634-639. doi: 10.1073/pnas.0406278102.
|
Dimeric parallel-stranded tetraplex with 3+1 5'
g-tetrad interface, single-residue chain reversal loops
and gag triad in the context of a(gggg) pentad .
➥ 6 G-tetrads, 1 G4 helix, 2 G4
stems, 1 G4 coaxial stack, UUUU, parallel, 4+0,
2(-P-P-P), coaxial interfaces: 5'/5'-SEPARATED
|
|
201d
|
DNA |
NMR |
Wang Y, Patel DJ |
(1995) "Solution
structure of the Oxytricha telomeric repeat
d[G4(T4G4)3] G-tetraplex." J.Mol.Biol.,
251, 76-94. doi: 10.1006/jmbi.1995.0417.
|
Solution structure of the oxytricha telomeric repeat
d[g4(t4g4)3] g-tetraplex . ➥
4 G-tetrads, 1 G4 helix,
1 G4 stem, UDDU, anti-parallel:basket, 2+2,
4(-LwD+Ln)
|
|
21cc
|
RNA |
NMR |
Iwakiri R, Wang SY, Xu Y |
"A solution NMR model of L-RNA r(UAGGGUUAGGGU)
bounding Protoporphyrin IX ligand." |
A solution NMR model of l-RNA r(uaggguuagggu) bounding
protoporphyrin ix ligand . ➥
3 G-tetrads, 1 G4 helix,
1 G4 stem, UUUU, parallel, 4+0, negative twist
|
|
230d
|
DNA |
NMR |
Smith FW, Schultze P, Feigon J |
(1995) "Solution
structures of unimolecular quadruplexes formed by
oligonucleotides containing Oxytricha telomere
repeats." Structure, 3,
997-1008. doi: 10.1016/S0969-2126(01)00236-2.
|
Solution structures of unimolecular quadruplexes formed
by oligonucleotides containing oxytricha telomere
repeats . ➥ 4 G-tetrads, 1 G4 helix, 1 G4
stem, UDDU, anti-parallel:basket, 2+2, 4(-LwD+Ln)
|
|
244d
|
DNA |
X-ray (1.2 Å) |
Laughlan G, Murchie AI, Norman DG, Moore MH, Moody
PC, Lilley DM, Luisi B |
(1994) "The
high-resolution crystal structure of a
parallel-stranded guanine tetraplex."
Science, 265, 520-524.
|
The high-resolution crystal structure of a
parallel-stranded guanine tetraplex . ➥ 4
G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel,
4+0
|
|
26jr
|
DNA |
NMR |
Li Y, Cao C |
"Structural Insights into the Binding of CX-5461 and
MTR-106 to G-Quadruplex DNA." |
NMR solution structures of mtr-106-myt1lcomplex .
➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UDUU, hybrid3, 3+1, 3(-Lw-Ln-P)
|
|
26jt
|
DNA |
NMR |
Li Y, Cao C |
"Structural Insights into the Binding of CX-5461 and
MTR-106 to G-Quadruplex DNA." |
NMR solution structures of cx-5461-myt1l complex .
➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UDUU, hybrid3, 3+1, 3(-Lw-Ln-P)
|
|
2a5p
|
DNA |
NMR |
Phan AT, Kuryavyi V, Gaw HY, Patel DJ |
(2005) "Small-molecule
interaction with a five-guanine-tract G-quadruplex
structure from the human MYC promoter."
Nat.Chem.Biol., 1, 167-173.
doi: 10.1038/nchembio723.
|
Monomeric parallel-stranded DNA tetraplex with
snap-back 3+1 3' g-tetrad, single-residue chain
reversal loops, gag triad in the context of gaag
diagonal loop, NMR, 8 struct. . ➥ 3
G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0,
2(-P-P-P)
|
|
2a5r
|
DNA |
NMR |
Phan AT, Kuryavyi V, Gaw HY, Patel DJ |
(2005) "Small-molecule
interaction with a five-guanine-tract G-quadruplex
structure from the human MYC promoter."
Nat.Chem.Biol., 1, 167-173.
doi: 10.1038/nchembio723.
|
Complex of tetra-(4-n-methylpyridyl) porphin with
monomeric parallel-stranded DNA tetraplex, snap-back
3+1 3' g-tetrad, single-residue chain reversal loops,
gag triad in the context of gaag diagonal loop, c-myc
promoter, NMR, 6 struct. . ➥
3 G-tetrads, 1 G4 helix,
1 G4 stem, UUUU, parallel, 4+0, 2(-P-P-P)
|
|
2akg
|
DNA |
NMR |
Gill ML, Strobel SA, Loria JP |
(2005) "(205)Tl
NMR methods for the characterization of monovalent
cation binding to nucleic acids."
J.Am.Chem.Soc., 127,
16723-16732. doi: 10.1021/ja055358f.
|
Thallium form of the g-quadruplex from oxytricha nova,
d(g4t4g4)2 . ➥ 4 G-tetrads, 1 G4 helix, 1 G4
stem, UDDU, anti-parallel:basket, 2+2
|
|
2aqy
|
DNA |
NMR |
Zhang N, Phan AT, Patel DJ |
(2005) "(3 + 1)
Assembly of three human telomeric repeats into an
asymmetric dimeric G-quadruplex."
J.Am.Chem.Soc., 127,
17277-17285. doi: 10.1021/ja0543090.
|
(3+1) assembly of three human telomeric DNA repeats
into an asymmetrical dimeric g-quadruplex .
➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUD, hybrid2, 3+1
|
|
2avh
|
DNA |
X-ray (1.5 Å) |
Hazel P, Parkinson GN, Neidle S |
(2006) "Topology
variation and loop structural homology in crystal and
simulated structures of a bimolecular DNA
quadruplex." J.Am.Chem.Soc.,
128, 5480-5487. doi: 10.1021/ja058577+.
|
G4t3g4 dimeric quadruplex structure . ➥ 4
G-tetrads, 1 G4 helix, 1 G4 stem, UDUD,
anti-parallel:chair, 2+2
|
|
2avj
|
DNA |
X-ray (2.39 Å) |
Hazel P, Parkinson GN, Neidle S |
(2006) "Topology
variation and loop structural homology in crystal and
simulated structures of a bimolecular DNA
quadruplex." J.Am.Chem.Soc.,
128, 5480-5487. doi: 10.1021/ja058577+.
|
G4(br)uttg4 dimeric quadruplex . ➥ 4
G-tetrads, 1 G4 helix, 1 G4 stem, UDUD,
anti-parallel:chair, 2+2
|
|
2awe
|
RNA |
X-ray (2.1 Å) |
Pan B, Shi K, Sundaralingam M |
(2006) "Base-tetrad
swapping results in dimerization of RNA quadruplexes:
implications for formation of the i-motif RNA
octaplex." Proc.Natl.Acad.Sci.Usa,
103, 3130-3134. doi: 10.1073/pnas.0507730103.
|
Base-tetrad swapping results in dimerization of RNA
quadruplexes: implications for formation of i-motif RNA
octaplex . ➥ 6 G-tetrads, 2 G4 helices, 2 G4
stems, UUUU, parallel, 4+0
|
|
2chj
|
nucleic acid |
NMR |
Nielsen JT, Arar K, Petersen M |
(2006) "NMR
Solution Structures of Lna (Locked Nucleic Acid)
Modified Quadruplexes." Nucleic Acids
Res., 34, 2006. doi: 10.1093/NAR/GKL144.
|
NMR structure of tglglt quadruplex . ➥ 4
G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel,
4+0
|
|
2chk
|
nucleic acid |
NMR |
Nielsen JT, Arar K, Petersen M |
(2006) "NMR
Solution Structures of Lna (Locked Nucleic Acid)
Modified Quadruplexes." Nucleic Acids
Res., 34, 2006. doi: 10.1093/NAR/GKL144.
|
NMR structure of tllllt quadruplex . ➥ 4
G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel,
4+0
|
|
2e4i
|
DNA |
NMR |
Matsugami A, Xu Y, Noguchi Y, Sugiyama H, Katahira
M |
(2007) "Structure
of a human telomeric DNA sequence stabilized by
8-bromoguanosine substitutions, as determined by NMR in
a K+ solution." Febs J.,
274, 3545-3556. doi: 10.1111/j.1742-4658.2007.05881.x.
|
Human telomeric DNA mixed-parallel-antiparallel
quadruplex under physiological ionic conditions
stabilized by proper incorporation of 8-bromoguanosines
. ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUDU, hybrid1, 3+1, 3(-P-Lw-Ln)
|
|
2f8u
|
DNA |
NMR |
Dai J, Chen D, Jones RA, Hurley LH, Yang D |
(2006) "NMR
solution structure of the major G-quadruplex structure
formed in the human BCL2 promoter region."
Nucleic Acids Res., 34,
5133-5144. doi: 10.1093/nar/gkl610.
|
G-quadruplex structure formed in human bcl-2 promoter,
hybrid form . ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UDUU, hybrid3, 3+1, 3(-Lw-Ln-P)
|
|
2gku
|
DNA |
NMR |
Luu KN, Phan AT, Kuryavyi VV, Lacroix L, Patel
DJ |
(2006) "Structure
of the human telomere in k(+) solution: an
intramolecular (3 + 1) g-quadruplex scaffold."
J.Am.Chem.Soc., 128,
9963-9970. doi: 10.1021/ja062791w.
|
Monomeric human telomere DNA tetraplex with 3+1 strand
fold topology, two edgewise loops and double-chain
reversal loop, NMR, 12 structures . ➥ 3
G-tetrads, 1 G4 helix, 1 G4 stem, UUDU, hybrid1, 3+1,
3(-P-Lw-Ln)
|
|
2grb
|
RNA |
X-ray (1.4 Å) |
Pan B, Shi K, Sundaralingam M |
(2006) "Crystal
structure of an RNA quadruplex containing inosine
tetrad: implications for the roles of NH2 group in
purine tetrads." J.Mol.Biol.,
363, 451-459. doi: 10.1016/j.jmb.2006.08.022.
|
Crystal structure of an RNA quadruplex containing
inosine-tetrad . ➥ 4 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0
|
|
2gw0
|
DNA |
X-ray (1.55 Å) |
Lee MP, Parkinson GN, Hazel P, Neidle S |
(2007) "Observation
of the coexistence of sodium and calcium ions in a DNA
G-quadruplex ion channel." J.Am.Chem.Soc.,
129, 10106-10107. doi: 10.1021/ja0740869.
|
A d(tggggt)- sodium and calcium complex. . ➥ 4
G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel,
4+0
|
|
2gwe
|
DNA |
X-ray (2.2 Å) |
Lee MPH, Haider S, Parkinson GN, Neidle S |
"Crystal structure of D(G4T4G4) with four and six
quadruplexes in the asymmetric unit." |
Crystal structure of d(g4t4g4) with six quadruplexes in
the asymmetric unit. . ➥
4 G-tetrads, 1 G4 helix,
1 G4 stem, UDDU, anti-parallel:basket, 2+2
|
|
2gwq
|
DNA |
X-ray (2.0 Å) |
Lee MPH, Haider S, Parkinson GN, Neidle S |
"Crystal structure of D(G4T4G4) with four and six
quadruplexes in the asymmetric unit." |
Crystal structure of d(g4t4g4) with four quadruplexes
in the asymmetric unit. . ➥
4 G-tetrads, 1 G4 helix,
1 G4 stem, UDDU, anti-parallel:basket, 2+2
|
|
2hbn
|
DNA |
X-ray (1.55 Å) |
Gill ML, Strobel SA, Loria JP |
(2006) "Crystallization
and characterization of the thallium form of the
Oxytricha nova G-quadruplex." Nucleic Acids
Res., 34, 4506-4514. doi:
10.1093/nar/gkl616.
|
Crystallization of the tl+-form of the oxytricha nova
g-quadruplex . ➥ 4 G-tetrads, 1 G4 helix, 1 G4
stem, UDDU, anti-parallel:basket, 2+2
|
|
2hri
|
DNA |
X-ray (2.09 Å) |
Parkinson GN, Ghosh R, Neidle S |
(2007) "Structural
basis for binding of porphyrin to human telomeres."
Biochemistry, 46, 2390-2397.
doi: 10.1021/bi062244n.
|
A parallel stranded human telomeric quadruplex in
complex with the porphyrin tmpyp4 . ➥ 3
G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel,
4+0
|
|
2hy9
|
DNA |
NMR |
Dai J, Punchihewa C, Ambrus A, Chen D, Jones RA, Yang
D |
(2007) "Structure
of the intramolecular human telomeric G-quadruplex in
potassium solution: a novel adenine triple
formation." Nucleic Acids Res.,
35, 2440-2450. doi: 10.1093/nar/gkm009.
|
Human telomere DNA quadruplex structure in k+ solution
hybrid-1 form . ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUDU, hybrid1, 3+1, 3(-P-Lw-Ln)
|
|
2idn
|
DNA |
NMR |
Martino L, Virno A, Randazzo A, Virgilio A, Esposito
V, Giancola C, Bucci M, Cirino G, Mayol L |
(2006) "A new
modified thrombin binding aptamer containing a 5'-5'
inversion of polarity site." Nucleic Acids
Res., 34, 6653-6662. doi:
10.1093/nar/gkl915.
|
NMR structure of a new modified thrombin binding
aptamer containing a 5'-5' inversion of polarity site .
➥ 2 G-tetrads, 1 G4 helix, 1 G4
stem, DDUD, ---???---, 1+3, 2(+Lm+Lw+Ln)
|
|
2jpz
|
DNA |
NMR |
Dai J, Carver M, Punchihewa C, Jones RA, Yang D |
(2007) "Structure
of the Hybrid-2 type intramolecular human telomeric
G-quadruplex in K+ solution: insights into structure
polymorphism of the human telomeric sequence."
Nucleic Acids Res., 35,
4927-4940. doi: 10.1093/nar/gkm522.
|
Human telomere DNA quadruplex structure in k+ solution
hybrid-2 form . ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UDUU, hybrid3, 3+1, 3(-Lw-Ln-P)
|
|
2jsk
|
DNA |
NMR |
Phan AT, Kuryavyi V, Luu KN, Patel DJ |
(2007) "Structure
of two intramolecular G-quadruplexes formed by natural
human telomere sequences in K+ solution."
Nucleic Acids Res., 35,
6517-6525. doi: 10.1093/nar/gkm706.
|
Monomeric human telomere DNA tetraplex with 3+1 strand
fold topology, two edgewise loops and double-chain
reversal loop, 16 g form 1, NMR, 10 structures .
➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUDU, hybrid1, 3+1, 3(-P-Lw-Ln)
|
|
2jsl
|
DNA |
NMR |
Phan AT, Kuryavyi V, Luu KN, Patel DJ |
(2007) "Structure
of two intramolecular G-quadruplexes formed by natural
human telomere sequences in K+ solution."
Nucleic Acids Res., 35,
6517-6525. doi: 10.1093/nar/gkm706.
|
Monomeric human telomere DNA tetraplex with 3+1 strand
fold topology, two edgewise loops and double-chain
reversal loop, form 2 natural, NMR, 10 structures .
➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UDUU, hybrid3, 3+1, 3(-Lw-Ln-P)
|
|
2jsm
|
DNA |
NMR |
Phan AT, Kuryavyi V, Luu KN, Patel DJ |
(2007) "Structure
of two intramolecular G-quadruplexes formed by natural
human telomere sequences in K+ solution."
Nucleic Acids Res., 35,
6517-6525. doi: 10.1093/nar/gkm706.
|
Monomeric human telomere DNA tetraplex with 3+1 strand
fold topology, two edgewise loops and double-chain
reversal loop, NMR, 10 structures, form 1 natural .
➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUDU, hybrid1, 3+1, 3(-P-Lw-Ln)
|
|
2jsq
|
DNA |
NMR |
Phan AT, Kuryavyi V, Luu KN, Patel DJ |
(2007) "Structure
of two intramolecular G-quadruplexes formed by natural
human telomere sequences in K+ solution."
Nucleic Acids Res., 35,
6517-6525. doi: 10.1093/nar/gkm706.
|
Monomeric human telomere DNA tetraplex with 3+1 strand
fold topology, two edgewise loops and double-chain
reversal loop, form 2 15brg, NMR, 10 structures .
➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UDUU, hybrid3, 3+1, 3(-Lw-Ln-P)
|
|
2jt7
|
DNA |
NMR |
Martino L, Virno A, Pagano B, Virgilio A, Di Micco S,
Galeone A, Giancola C, Bifulco G, Mayol L, Randazzo
A |
(2007) "Structural
and thermodynamic studies of the interaction of
distamycin A with the parallel quadruplex structure
[d(TGGGGT)]4." J.Am.Chem.Soc.,
129, 16048-16056. doi: 10.1021/ja075710k.
|
NMR solution structure of the 4:1 distamycin
a-[d(tggggt)]4 complex . ➥
4 G-tetrads, 1 G4 helix,
1 G4 stem, UUUU, parallel, 4+0
|
|
2jwq
|
DNA |
NMR |
Hounsou C, Guittat L, Monchaud D, Jourdan M, Saettel
N, Mergny JL, Teulade-Fichou M |
(2007) "G-Quadruplex
Recognition by Quinacridines: a SAR, NMR, and
Biological Study." ChemMedChem,
2, 655-666. doi: 10.1002/cmdc.200600286.
|
G-quadruplex recognition by quinacridines: a sar, NMR
and biological study . ➥
3 G-tetrads, 1 G4 helix,
1 G4 stem, UUUU, parallel, 4+0
|
|
2kaz
|
DNA |
NMR |
Balkwill GD, Garner TP, Williams HE, Searle MS |
(2009) "Folding
topology of a bimolecular DNA quadruplex containing a
stable mini-hairpin motif within the diagonal
loop." J.Mol.Biol., 385,
1600-1615. doi: 10.1016/j.jmb.2008.11.050.
|
Folding topology of a bimolecular DNA quadruplex
containing a stable mini-hairpin motif within the
connecting loop . ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUDD, anti-parallel:basket2, 2+2
|
|
2kbp
|
RNA |
NMR |
Martadinata H, Phan AT |
(2009) "Structure
of propeller-type parallel-stranded RNA G-quadruplexes,
formed by human telomeric RNA sequences in K+
solution." J.Am.Chem.Soc.,
131, 2570-2578. doi: 10.1021/ja806592z.
|
Solution structure of a g-quadruplex of human telomeric
RNA . ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0
|
|
2kf7
|
DNA |
NMR |
Lim KW, Amrane S, Bouaziz S, Xu W, Mu Y, Patel DJ,
Luu KN, Phan AT |
(2009) "Structure
of the human telomere in K+ solution: a stable
basket-type G-quadruplex with only two G-tetrad
layers." J.Am.Chem.Soc.,
131, 4301-4309. doi: 10.1021/ja807503g.
|
Structure of a two-g-tetrad basket-type intramolecular
g-quadruplex formed by human telomeric repeats in k+
solution (with g7-to-brg substitution) . ➥ 2
G-tetrads, 1 G4 helix, 1 G4 stem, UDDU,
anti-parallel:basket, 2+2, 2(-LwD+Ln)
|
|
2kf8
|
DNA |
NMR |
Lim KW, Amrane S, Bouaziz S, Xu W, Mu Y, Patel DJ,
Luu KN, Phan AT |
(2009) "Structure
of the human telomere in K+ solution: a stable
basket-type G-quadruplex with only two G-tetrad
layers." J.Am.Chem.Soc.,
131, 4301-4309. doi: 10.1021/ja807503g.
|
Structure of a two-g-tetrad basket-type intramolecular
g-quadruplex formed by human telomeric repeats in k+
solution . ➥ 2 G-tetrads, 1 G4 helix, 1 G4
stem, UDDU, anti-parallel:basket, 2+2, 2(-LwD+Ln)
|
|
2kka
|
DNA |
NMR |
Zhang Z, Dai J, Veliath E, Jones RA, Yang D |
(2010) "Structure
of a two-G-tetrad intramolecular G-quadruplex formed by
a variant human telomeric sequence in K+ solution:
insights into the interconversion of human telomeric
G-quadruplex structures." Nucleic Acids
Res., 38, 1009-1021. doi:
10.1093/nar/gkp1029.
|
Human telomere DNA two-tetrad quadruplex structure in
k+ solution . ➥ 2 G-tetrads, 1 G4 helix, 1 G4
stem, UDDU, anti-parallel:basket, 2+2, 2(-LwD+Ln)
|
|
2km3
|
DNA |
NMR |
Lim KW, Alberti P, Guedin A, Lacroix L, Riou JF,
Royle NJ, Mergny JL, Phan AT |
(2009) "Sequence
variant (CTAGGG)n in the human telomere favors a
G-quadruplex structure containing a G.C.G.C
tetrad." Nucleic Acids Res.,
37, 6239-6248. doi: 10.1093/nar/gkp630.
|
Structure of an intramolecular g-quadruplex containing
a g.c.g.c tetrad formed by human telomeric variant
ctaggg repeats . ➥ 2 G-tetrads, 1 G4 helix, 1 G4
stem, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
|
|
2kow
|
DNA |
NMR |
Hu L, Lim KW, Bouaziz S, Phan AT |
(2009) "Giardia
Telomeric Sequence d(TAGGG)(4) Forms Two Intramolecular
G-Quadruplexes in K(+) Solution: Effect of Loop Length
and Sequence on the Folding Topology."
J.Am.Chem.Soc., 131,
16824-16831. doi: 10.1021/ja905611c.
|
Structure of a two-g-tetrad basket-type intramolecular
g-quadruplex formed by giardia telomeric repeat
d(taggg)4 in k+ solution (with g18-to-ino substitution)
. ➥ 2 G-tetrads, 1 G4 helix, 1 G4
stem, UUDD, anti-parallel:basket2, 2+2, 2(+LnD-Lw)
|
|
2kpr
|
DNA |
NMR |
Kuryavyi V, Patel DJ |
(2010) "Solution
Structure of a Unique G-Quadruplex Scaffold Adopted by
a Guanosine-Rich Human Intronic Sequence."
Structure, 18, 73-82. doi:
10.1016/j.str.2009.10.015.
|
Monomeric intronic human chl1 gene quadruplex DNA NMR,
17 structures . ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UDDD, hybrid4, 1+3, 2(-LwX+P)
|
|
2kqg
|
DNA |
NMR |
Hsu S-TD, Varnai P, Bugaut A, Reszka AP, Neidle S,
Balasubramanian S |
(2009) "A G-rich
sequence within the c-kit oncogene promoter forms a
parallel G-quadruplex having asymmetric G-tetrad
dynamics." J.Am.Chem.Soc.,
131, 13399-13409. doi: 10.1021/ja904007p.
|
A g-rich sequence within the c-kit oncogene promoter
forms a parallel g-quadruplex having asymmetric
g-tetrad dynamics . ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
2kqh
|
DNA |
NMR |
Hsu S-TD, Varnai P, Bugaut A, Reszka AP, Neidle S,
Balasubramanian S |
(2009) "A G-rich
sequence within the c-kit oncogene promoter forms a
parallel G-quadruplex having asymmetric G-tetrad
dynamics." J.Am.Chem.Soc.,
131, 13399-13409. doi: 10.1021/ja904007p.
|
A g-rich sequence within the c-kit oncogene promoter
forms a parallel g-quadruplex having asymmetric
g-tetrad dynamics . ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
2kvy
|
DNA |
NMR |
Cosconati S, Marinelli L, Trotta R, Virno A, De Tito
S, Romagnoli R, Pagano B, Limongelli V, Giancola C,
Baraldi PG, Mayol L, Novellino E, Randazzo A |
(2010) "Structural
and conformational requisites in DNA quadruplex groove
binding: another piece to the puzzle."
J.Am.Chem.Soc., 132,
6425-6433. doi: 10.1021/ja1003872.
|
NMR solution structure of the 4:1 complex between an
uncharged distamycin a analogue and [d(tggggt)]4 .
➥ 4 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0
|
|
2kyo
|
DNA |
NMR |
Kuryavyi V, Phan AT, Patel DJ |
(2010) "Solution
structures of all parallel-stranded monomeric and
dimeric G-quadruplex scaffolds of the human c-kit2
promoter." Nucleic Acids Res.,
38, 6757-6773. doi: 10.1093/nar/gkq558.
|
Dimeric human ckit-2 proto-oncogene promoter quadruplex
DNA NMR, 10 structures . ➥
6 G-tetrads, 2 G4
helices, 2 G4 stems, UUUU, parallel, 4+0
|
|
2kyp
|
DNA |
NMR |
Kuryavyi V, Phan AT, Patel DJ |
(2010) "Solution
structures of all parallel-stranded monomeric and
dimeric G-quadruplex scaffolds of the human c-kit2
promoter." Nucleic Acids Res.,
38, 6757-6773. doi: 10.1093/nar/gkq558.
|
Monomeric human ckit-2 proto-oncogene promoter
quadruplex DNA NMR, 12 structures . ➥ 3
G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0,
3(-P-P-P)
|
|
2kzd
|
DNA |
NMR |
Lim KW, Lacroix L, Yue DJE, Lim JKC, Lim JMW, Phan
AT |
(2010) "Coexistence
of two distinct G-quadruplex conformations in the hTERT
promoter." J.Am.Chem.Soc.,
132, 12331-12342. doi: 10.1021/ja101252n.
|
Structure of a (3+1) g-quadruplex formed by htert
promoter sequence . ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UDUU, hybrid3, 3+1, 3(-Lw-Ln-P)
|
|
2kze
|
DNA |
NMR |
Lim KW, Lacroix L, Yue DJE, Lim JKC, Lim JMW, Phan
AT |
(2010) "Coexistence
of two distinct G-quadruplex conformations in the hTERT
promoter." J.Am.Chem.Soc.,
132, 12331-12342. doi: 10.1021/ja101252n.
|
Structure of an all-parallel-stranded g-quadruplex
formed by htert promoter sequence . ➥ 3
G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0,
3(-P-P-P)
|
|
2l7v
|
DNA-inhibitor |
NMR |
Dai J, Carver M, Hurley LH, Yang D |
(2011) "Solution
Structure of a 2:1 Quindoline-c-MYC G-Quadruplex:
Insights into G-Quadruplex-Interactive Small Molecule
Drug Design." J.Am.Chem.Soc.,
133, 17673-17680. doi: 10.1021/ja205646q.
|
Quindoline-g-quadruplex complex . ➥ 3
G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0,
3(-P-P-P)
|
|
2l88
|
DNA |
NMR |
Tong X, Lan W, Zhang X, Wu H, Liu M, Cao C |
(2011) "Solution
structure of all parallel G-quadruplex formed by the
oncogene RET promoter sequence." Nucleic Acids
Res., 39, 6753-6763. doi:
10.1093/nar/gkr233.
|
Solution structure of all parallel g-quadruplex formed
by the oncogene ret promoter sequence . ➥ 3
G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0,
3(-P-P-P)
|
|
2la5
|
RNA binding protein-RNA |
NMR |
Phan AT, Kuryavyi V, Darnell JC, Serganov A, Majumdar
A, Ilin S, Raslin T, Polonskaia A, Chen C, Clain D,
Darnell RB, Patel DJ |
(2011) "Structure-function
studies of FMRP RGG peptide recognition of an RNA
duplex-quadruplex junction."
Nat.Struct.Mol.Biol., 18,
796-804. doi: 10.1038/nsmb.2064.
|
RNA duplex-quadruplex junction complex with fmrp rgg
peptide . ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 2(-P-P-P)
|
|
2lby
|
DNA |
NMR |
Mathad RI, Hatzakis E, Dai J, Yang D |
(2011) "c-MYC
promoter G-quadruplex formed at the 5'-end of NHE III1
element: insights into biological relevance and
parallel-stranded G-quadruplex stability."
Nucleic Acids Res., 39,
9023-9033. doi: 10.1093/nar/gkr612.
|
G-quadruplex structure formed at the 5'-end of nheiii_1
element in human c-myc promoter . ➥ 3
G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0,
3(-P-P-P)
|
|
2ld8
|
DNA |
NMR |
Heddi B, Phan AT |
(2011) "Structure
of Human Telomeric DNA in Crowded Solution."
J.Am.Chem.Soc. doi: 10.1021/ja200786q.
|
Structure of human telomeric DNA in crowded solution .
➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
2le6
|
DNA |
NMR |
Do NQ, Lim KW, Teo MH, Heddi B, Phan AT |
(2011) "Stacking
of G-quadruplexes: NMR structure of a G-rich
oligonucleotide with potential anti-HIV and anticancer
activity." Nucleic Acids Res. doi:
10.1093/nar/gkr539.
|
Structure of a dimeric all-parallel-stranded
g-quadruplex stacked via the 5'-to-5' interface .
➥ 6 G-tetrads, 1 G4 helix, 2 G4
stems, 1 G4 coaxial stack, UUUU, parallel, 4+0,
3(-P-P-P), coaxial interfaces: 5'/5'
|
|
2led
|
DNA |
NMR |
Trajkovski M, Webba da Silva M, Plavec J |
(2012) "Unique
Structural Features of Interconverting Monomeric and
Dimeric G-Quadruplexes Adopted by a Sequence from the
Intron of the N-myc Gene." J.Am.Chem.Soc.,
134, 4132-4141. doi: 10.1021/ja208483v.
|
Unique structural features of interconverting monomeric
and dimeric g-quadruplexes adopted by a sequence from
intron of n-myc gene . ➥
6 G-tetrads, 1 G4 helix,
2 G4 stems, 1 G4 coaxial stack, UUUU, parallel, 4+0,
coaxial interfaces: 3'/5'
|
|
2lee
|
DNA |
NMR |
Trajkovski M, Webba da Silva M, Plavec J |
(2012) "Unique
Structural Features of Interconverting Monomeric and
Dimeric G-Quadruplexes Adopted by a Sequence from the
Intron of the N-myc Gene." J.Am.Chem.Soc.,
134, 4132-4141. doi: 10.1021/ja208483v.
|
Unique structural features of interconverting monomeric
and dimeric g-quadruplexes adopted by a sequence from
intron of n-myc gene . ➥
3 G-tetrads, 1 G4 helix,
1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
2lk7
|
DNA |
NMR |
Do NQ, Phan AT |
(2012) "Monomer-Dimer
Equilibrium for the 5'-5' Stacking of Propeller-Type
Parallel-Stranded G-Quadruplexes: NMR Structural
Study." Chemistry. doi: 10.1002/chem.201103295.
|
Monomer-dimer equilibrium for 5'-5' stacking of
propeller-type parallel-stranded g-quadruplexes: NMR
structural study . ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
2lod
|
DNA |
NMR |
Marusic M, Sket P, Bauer L, Viglasky V, Plavec J |
(2012) "Solution-state
structure of an intramolecular G-quadruplex with
propeller, diagonal and edgewise loops."
Nucleic Acids Res., 40,
6946-6956. doi: 10.1093/nar/gks329.
|
Solution-state structure of an intramolecular
g-quadruplex with propeller, diagonal and edgewise
loops . ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUD, hybrid2, 3+1, 3(-PD+Lw)
|
|
2lpw
|
DNA |
NMR |
Amrane S, Adrian M, Heddi B, Serero A, Nicolas A,
Mergny JL, Phan AT |
(2012) "Formation
of Pearl-Necklace Monomorphic G-Quadruplexes in the
Human CEB25 Minisatellite."
J.Am.Chem.Soc., 134,
5807-5816. doi: 10.1021/ja208993r.
|
Human ceb25 minisatellite g-quadruplex . ➥ 3
G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0,
3(-P-P-P)
|
|
2lxq
|
DNA |
NMR |
Kuryavyi V, Cahoon LA, Seifert HS, Patel DJ |
(2012) "RecA-Binding
pilE G4 Sequence Essential for Pilin Antigenic
Variation Forms Monomeric and 5' End-Stacked Dimeric
Parallel G-Quadruplexes." Structure,
20, 2090-2102. doi: 10.1016/j.str.2012.09.013.
|
Monomeric pile g-quadruplex DNA from neisseria
gonorrhoeae . ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
2lxv
|
DNA |
NMR |
Kuryavyi V, Cahoon LA, Seifert HS, Patel DJ |
(2012) "RecA-Binding
pilE G4 Sequence Essential for Pilin Antigenic
Variation Forms Monomeric and 5' End-Stacked Dimeric
Parallel G-Quadruplexes." Structure,
20, 2090-2102. doi: 10.1016/j.str.2012.09.013.
|
Dimeric pil-e g-quadruplex DNA from neisseria
gonorrhoeae, NMR 11 structures . ➥ 6
G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack,
UUUU, parallel, 4+0, 3(-P-P-P), coaxial interfaces:
5'/5'
|
|
2lyg
|
DNA |
NMR |
Gomez-Pinto I, Vengut-Climent E, Lucas R, Avino A,
Eritja R, Gonzalez C, Morales JC |
(2013) "Carbohydrate-DNA
interactions at G-quadruplexes: folding and stability
changes by attaching sugars at the 5'-end."
Chemistry, 19, 1920-1927.
doi: 10.1002/chem.201203902.
|
Fuc_tba . ➥ 2 G-tetrads, 1 G4 helix, 1 G4
stem, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
|
|
2m18
|
RNA |
NMR |
Martadinata H, Phan AT |
(2013) "Structure
of Human Telomeric RNA (TERRA): Stacking of Two
G-Quadruplex Blocks in K(+) Solution."
Biochemistry, 52, 2176-2183.
doi: 10.1021/bi301606u.
|
Structure of stacked g-quadruplex formed by human terra
sequence in potassium solution . ➥ 6
G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack,
UUUU, parallel, 4+0, coaxial interfaces: 5'/5'
|
|
2m1g
|
DNA |
NMR |
Martin-Pintado N, Yahyaee-Anzahaee M, Deleavey GF,
Portella G, Orozco M, Damha MJ, Gonzalez C |
(2013) "Dramatic
effect of furanose c2' substitution on structure and
stability: directing the folding of the human telomeric
quadruplex with a single fluorine atom."
J.Am.Chem.Soc., 135,
5344-5347. doi: 10.1021/ja401954t.
|
Parallel human telomeric quadruplex containing 2'f-ana
substitutions . ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0
|
|
2m27
|
DNA |
NMR |
Agrawal P, Hatzakis E, Guo K, Carver M, Yang D |
(2013) "Solution
structure of the major G-quadruplex formed in the human
VEGF promoter in K+: insights into loop interactions of
the parallel G-quadruplexes." Nucleic Acids
Res., 41, 10584-10592. doi:
10.1093/nar/gkt784.
|
Major g-quadruplex structure formed in human vegf
promoter, a monomeric parallel-stranded quadruplex .
➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
2m4p
|
DNA |
NMR |
Mukundan VT, Phan AT |
(2013) "Bulges
in G-Quadruplexes: Broadening the Definition of
G-Quadruplex-Forming Sequences."
J.Am.Chem.Soc., 135,
5017-5028. doi: 10.1021/ja310251r.
|
Solution structure of an intramolecular propeller-type
g-quadruplex containing a single bulge . ➥ 3
G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0,
3(-P-P-P)
|
|
2m53
|
DNA |
NMR |
Marusic M, Veedu RN, Wengel J, Plavec J |
(2013) "G-rich
VEGF aptamer with locked and unlocked nucleic acid
modifications exhibits a unique G-quadruplex fold."
Nucleic Acids Res., 41,
9524-9536. doi: 10.1093/nar/gkt697.
|
G-rich vegf aptamer with lna modifications .
➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 2(-P-P-P)
|
|
2m6v
|
DNA |
NMR |
Dvorkin SA, Karsisiotis AI, Webba da Silva M |
(2018) "Encoding
canonical DNA quadruplex structure." Sci
Adv, 4, eaat3007. doi: 10.1126/sciadv.aat3007.
|
Solution NMR structure of the d(gggttgggttttgggtggg)
quadruplex in sodium conditions . ➥ 2
G-tetrads, 1 G4 helix, 1 G4 stem, UDDU,
anti-parallel:basket, 2+2, 2(-LwD+Ln)
|
|
2m6w
|
DNA |
NMR |
Dvorkin SA, Karsisiotis AI, Webba da Silva M |
(2018) "Encoding
canonical DNA quadruplex structure." Sci
Adv, 4, eaat3007. doi: 10.1126/sciadv.aat3007.
|
Solution NMR structure of the
d(ggggttggggttttggggaagggg) quadruplex in sodium
conditions . ➥ 4 G-tetrads, 1 G4 helix, 1 G4
stem, UDDU, anti-parallel:basket, 2+2, 4(-LwD+Ln)
|
|
2m8z
|
DNA |
NMR |
Lim KW, Phan AT |
(2013) "Structural
basis of DNA quadruplex-duplex junction formation."
Angew.Chem.Int.Ed.Engl., 52,
8566-8569. doi: 10.1002/anie.201302995.
|
Structure of d[ggttggcgcgaagcattcgcgggttgg]
quadruplex-duplex hybrid . ➥
2 G-tetrads, 1 G4 helix,
1 G4 stem, UDUD, anti-parallel:chair, 2+2,
2(+Ln+Lw+Ln)
|
|
2m90
|
DNA |
NMR |
Lim KW, Phan AT |
(2013) "Structural
basis of DNA quadruplex-duplex junction formation."
Angew.Chem.Int.Ed.Engl., 52,
8566-8569. doi: 10.1002/anie.201302995.
|
Structure of d[gcgcgaagcattcgcggggaggtggggaaggg]
quadruplex-duplex hybrid . ➥
3 G-tetrads, 1 G4 helix,
1 G4 stem, UUUU, parallel, 4+0, 2(-P-P-P)
|
|
2m91
|
DNA |
NMR |
Lim KW, Phan AT |
(2013) "Structural
basis of DNA quadruplex-duplex junction formation."
Angew.Chem.Int.Ed.Engl., 52,
8566-8569. doi: 10.1002/anie.201302995.
|
Structure of d[gggaagggcgcgaagcattcgcgaggtagg]
quadruplex-duplex hybrid . ➥
2 G-tetrads, 1 G4 helix,
1 G4 stem, UDDU, anti-parallel:basket, 2+2,
2(-LwD+Ln)
|
|
2m92
|
DNA |
NMR |
Lim KW, Phan AT |
(2013) "Structural
basis of DNA quadruplex-duplex junction formation."
Angew.Chem.Int.Ed.Engl., 52,
8566-8569. doi: 10.1002/anie.201302995.
|
Structure of d[agggtgggtgctggggcgcgaagcattcgcgagg]
quadruplex-duplex hybrid . ➥
3 G-tetrads, 1 G4 helix,
1 G4 stem, UUUU, parallel, 4+0, 2(-PX+P)
|
|
2m93
|
DNA |
NMR |
Lim KW, Phan AT |
(2013) "Structural
basis of DNA quadruplex-duplex junction formation."
Angew.Chem.Int.Ed.Engl., 52,
8566-8569. doi: 10.1002/anie.201302995.
|
Structure of d[ttgggtgggcgcgaagcattcgcggggtgggt]
quadruplex-duplex hybrid . ➥
3 G-tetrads, 1 G4 helix,
1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
2may
|
DNA |
NMR |
Li Z, Lech C, Adrian M, Heddi B, Phan AT |
"Engineering G4: Towards effective incorporation of
locked nucleic acid into G-quadruplexes." |
Structure of a g-quadruplex containing a single lna
modification . ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUDU, hybrid1, 3+1, 3(-P-Lw-Ln)
|
|
2mb2
|
DNA |
NMR |
Sengar A, Heddi B, Phan AT |
(2014) "Formation
of g-quadruplexes in poly-g sequences: structure of a
propeller-type parallel-stranded g-quadruplex formed by
a g15 stretch." Biochemistry,
53, 7718-7723. doi: 10.1021/bi500990v.
|
Parallel-stranded g-quadruplex in DNA poly-g stretches
. ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
2mb3
|
DNA-DNA inhibitor |
NMR |
Chung WJ, Heddi B, Tera M, Iida K, Nagasawa K, Phan
AT |
(2013) "Solution
structure of an intramolecular (3 + 1) human telomeric
g-quadruplex bound to a telomestatin derivative."
J.Am.Chem.Soc., 135,
13495-13501. doi: 10.1021/ja405843r.
|
Solution structure of an intramolecular (3+1) human
telomeric g-quadruplex bound to a telomestatin
derivative . ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUDU, hybrid1, 3+1, 3(-P-Lw-Ln)
|
|
2mb4
|
DNA |
NMR |
Adrian M, Ang DJ, Lech CJ, Heddi B, Nicolas A, Phan
AT |
(2014) "Structure
and Conformational Dynamics of a Stacked Dimeric
G-Quadruplex Formed by the Human CEB1
Minisatellite." J.Am.Chem.Soc.,
136, 6297-6305. doi: 10.1021/ja4125274.
|
Solution structure of a stacked dimeric g-quadruplex
formed by a segment of the human ceb1 minisatellite .
➥ 6 G-tetrads, 1 G4 helix, 2 G4
stems, 1 G4 coaxial stack, UUUU, parallel, 4+0,
2(-P-P-P), coaxial interfaces: 5'/5'
|
|
2mbj
|
DNA |
NMR |
Lim KW, Ng VC, Martin-Pintado N, Heddi B, Phan
AT |
(2013) "Structure
of the human telomere in Na+ solution: an antiparallel
(2+2) G-quadruplex scaffold reveals additional
diversity." Nucleic Acids Res.,
41, 10556-10562. doi: 10.1093/nar/gkt771.
|
Structure of an antiparallel (2+2) g-quadruplex formed
by human telomeric repeats in na+ solution (with
g22-to-brg substitution) . ➥
3 G-tetrads, 1 G4 helix,
1 G4 stem, UUDD, anti-parallel:basket2, 2+2,
3(+Ln+P+Lw)
|
|
2mcc
|
DNA |
NMR |
Wilson T, Costa PJ, Felix V, Williamson MP, Thomas
JA |
(2013) "Structural
Studies on Dinuclear Ruthenium(II) Complexes That Bind
Diastereoselectively to an Antiparallel Folded Human
Telomere Sequence." J.Med.Chem.,
56, 8674-8683. doi: 10.1021/jm401119b.
|
Structural studies on dinuclear ruthenium(ii) complexes
that bind diastereoselectively to an anti-parallel
folded human telomere sequence . ➥ 3
G-tetrads, 1 G4 helix, 1 G4 stem, UDDU,
anti-parallel:basket, 2+2, 3(-LwD+Ln)
|
|
2mco
|
DNA |
NMR |
Wilson T, Costa PJ, Felix V, Williamson MP, Thomas
JA |
(2013) "Structural
Studies on Dinuclear Ruthenium(II) Complexes That Bind
Diastereoselectively to an Antiparallel Folded Human
Telomere Sequence." J.Med.Chem.,
56, 8674-8683. doi: 10.1021/jm401119b.
|
Structural studies on dinuclear ruthenium(ii) complexes
that bind diastereoselectively to an anti-parallel
folded human telomere sequence . ➥ 3
G-tetrads, 1 G4 helix, 1 G4 stem, UDDU,
anti-parallel:basket, 2+2, 3(-LwD+Ln)
|
|
2mft
|
DNA |
NMR |
Karsisiotis AI, Webba da Silva M |
"Solution NMR structure of the
d(GGGTTTTGGGTGGGTTTTGGG) quadruplex in sodium
conditions." |
Solution NMR structure of the d(gggttttgggtgggttttggg)
quadruplex in sodium conditions . ➥ 3
G-tetrads, 1 G4 helix, 1 G4 stem, UDDU,
anti-parallel:basket, 2+2, 3(D+PD)
|
|
2mfu
|
DNA |
NMR |
Karsisiotis A, Dillon P, Webba da Silva M |
"Solution NMR structure of quadruplex
d(TGGGTTTGGGTTGGGTTTGGG) in sodium conditions." |
Solution NMR structure of quadruplex
d(tgggtttgggttgggtttggg) in sodium conditions .
➥ 2 G-tetrads, 1 G4 helix, 1 G4
stem, UDUU, hybrid3, 3+1, 2(-Lw-Ln-P)
|
|
2mgn
|
DNA |
NMR |
Chung WJ, Heddi B, Hamon F, Teulade-Fichou MP, Phan
AT |
(2014) "Solution
Structure of a G-quadruplex Bound to the Bisquinolinium
Compound Phen-DC3."
Angew.Chem.Int.Ed.Engl., 53,
999-1002. doi: 10.1002/anie.201308063.
|
Solution structure of a g-quadruplex bound to the
bisquinolinium compound phen-dc3 . ➥ 3
G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0,
2(-P-P-P)
|
|
2ms6
|
DNA |
NMR |
Tawani A, Kumar A |
(2015) "Structural
Insight into the interaction of Flavonoids with Human
Telomeric Sequence." Sci Rep,
5, 17574. doi: 10.1038/srep17574.
|
Human telomeric g-quadruplex DNA sequence (ttagggt)4
complexed with flavonoid quercetin . ➥ 3
G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel,
4+0
|
|
2ms9
|
DNA |
NMR |
Chung WJ, Heddi B, Schmitt E, Lim KW, Mechulam Y,
Phan AT |
(2015) "Structure of a left-handed DNA G-quadruplex."
Proc.Natl.Acad.Sci.USA. |
Solution structure of a g-quadruplex . ➥ 4
G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0,
2(+P+P+P), negative twist
|
|
2mwz
|
DNA |
NMR |
Cheong VV, Heddi B, Lech CJ, Phan AT |
(2015) "Xanthine
and 8-oxoguanine in G-quadruplexes: formation of a GGXO
tetrad." Nucleic Acids Res.,
43, 10506-10514. doi: 10.1093/nar/gkv826.
|
Xanthine and 8-oxoguanine in g-quadruplexes: formation
of a g g x o tetrad . ➥
3 G-tetrads, 1 G4 helix,
1 G4 stem, UUDU, hybrid1, 3+1, 3(-P-Lw-Ln)
|
|
2n21
|
hydrolase-DNA |
NMR |
Heddi B, Cheong VV, Martadinata H, Phan AT |
(2015) "Insights
into G-quadruplex specific recognition by the DEAH-box
helicase RHAU: Solution structure of a
peptide-quadruplex complex."
Proc.Natl.Acad.Sci.USA, 112,
9608-9613. doi: 10.1073/pnas.1422605112.
|
Solution structure of complex between DNA g-quadruplex
and g-quadruplex recognition domain of rhau .
➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
2n2d
|
DNA |
NMR |
Brcic J, Plavec J |
(2015) "Solution
structure of a DNA quadruplex containing ALS and FTD
related GGGGCC repeat stabilized by
8-bromodeoxyguanosine substitution." Nucleic
Acids Res., 43, 8590-8600. doi:
10.1093/nar/gkv815.
|
Structure of DNA g-quadruplex adopted by als and ftd
related ggggcc repeat with g21 to br-g21 substitution .
➥ 4 G-tetrads, 1 G4 helix, 1 G4
stem, UDUD, anti-parallel:chair, 2+2, 4(+Ln+Lw+Ln)
|
|
2n3m
|
DNA |
NMR |
Do NQ, Chung WJ, Truong THA, Heddi B, Phan AT |
"G-quadruplex structure of an anti-proliferative DNA
sequence." |
G-quadruplex structure of an anti-proliferative DNA
sequence . ➥ 4 G-tetrads, 1 G4 helix, 2 G4
stems, 1 G4 coaxial stack, UUUU, parallel, 4+0,
2(-P-P-P), coaxial interfaces: 3'/5'
|
|
2n4y
|
DNA |
NMR |
De Nicola B, Lech CJ, Heddi B, Regmi S, Frasson I,
Perrone R, Richter SN, Phan AT |
(2016) "Structure
and possible function of a G-quadruplex in the long
terminal repeat of the proviral HIV-1 genome."
Nucleic Acids Res., 44,
6442-6451. doi: 10.1093/nar/gkw432.
|
Structure and possible function of a g-quadruplex in
the long terminal repeat of the proviral hiv-1 genome .
➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
2n60
|
DNA |
NMR |
Heddi B, Martin-Pintado N, Serimbetov Z, Kari TM,
Phan AT |
(2016) "G-quadruplexes
with (4n - 1) guanines in the G-tetrad core: formation
of a G-triadwater complex and implication for
small-molecule binding." Nucleic Acids
Res., 44, 910-916. doi: 10.1093/nar/gkv1357.
|
G-quadruplexes with (4n-1) guanines in the g-tetrad
core: formation of a g-triad water complex and
implication for small-molecule binding . ➥ 2
G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0,
2(-P-P-P)
|
|
2n6c
|
DNA |
NMR |
Kumar A, Tawani A |
"Solution structure for quercetin complexed with
c-myc G-quadruplex DNA." |
Solution structure for quercetin complexed with c-myc
g-quadruplex DNA . ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 2(-P-P-P)
|
|
2n9q
|
DNA |
NMR |
Thevarpadam J, Bessi I, Binas O, Goncalves DP, Slavov
C, Jonker HR, Richter C, Wachtveitl J, Schwalbe H, Heckel
A |
(2016) "Photoresponsive
Formation of an Intermolecular Minimal G-Quadruplex
Motif." Angew.Chem.Int.Ed.Engl.,
55, 2738-2742. doi: 10.1002/anie.201510269.
|
Photoswitchable g-quadruplex . ➥ 4
G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack,
UDUD, anti-parallel:chair, 2+2, coaxial interfaces:
mixed
|
|
2o3m
|
DNA |
NMR |
Phan AT, Kuryavyi VV, Burge S, Neidle S, Patel
DJ |
(2007) "Structure
of an unprecedented G-quadruplex scaffold in the human
c-kit promoter." J.Am.Chem.Soc.,
129, 4386-4392. doi: 10.1021/ja068739h.
|
Monomeric g-DNA tetraplex from human c-kit promoter .
➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 2(-PX+P)
|
|
2o4f
|
DNA |
X-ray (1.5 Å) |
Creze C, Rinaldi B, Haser R, Bouvet P, Gouet P |
(2007) "Structure
of a d(TGGGGT) quadruplex crystallized in the presence
of Li+ ions." Acta Crystallogr.,Sect.D,
63, 682-688. doi: 10.1107/S0907444907013315.
|
Structure of a parallel-stranded guanine tetraplex
crystallised with monovalent ions . ➥ 4
G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel,
4+0
|
|
2rqj
|
RNA |
NMR |
Mashima T, Matsugami A, Nishikawa F, Nishikawa S,
Katahira M |
(2009) "Unique
quadruplex structure and interaction of an RNA aptamer
against bovine prion protein." Nucleic Acids
Res., 37, 6249-6258. doi:
10.1093/nar/gkp647.
|
Quadruplex structure of an RNA aptamer against bovine
prion protein . ➥ 4 G-tetrads, 1 G4 helix, 2 G4
stems, 1 G4 coaxial stack, UUUU, parallel, 4+0,
2(-P-P-P), coaxial interfaces: 5'/5'
|
|
2rsk
|
membrane protein-RNA |
NMR |
Mashima T, Nishikawa F, Kamatari YO, Fujiwara H,
Saimura M, Nagata T, Kodaki T, Nishikawa S, Kuwata K,
Katahira M |
(2013) "Anti-prion
activity of an RNA aptamer and its structural
basis." Nucleic Acids Res.,
41, 1355-1362. doi: 10.1093/nar/gks1132.
|
RNA aptamer against prion protein in complex with the
partial binding peptide . ➥
4 G-tetrads, 1 G4 helix,
2 G4 stems, 1 G4 coaxial stack, UUUU, parallel, 4+0,
2(-P-P-P), coaxial interfaces: 5'/5'
|
|
2ru7
|
membrane protein-RNA |
NMR |
Hayashi T, Oshima H, Mashima T, Nagata T, Katahira M,
Kinoshita M |
(2014) "Binding
of an RNA aptamer and a partial peptide of a prion
protein: crucial importance of water entropy in
molecular recognition." Nucleic Acids
Res., 42, 6861-6875. doi:
10.1093/nar/gku382.
|
Refined structure of RNA aptamer in complex with the
partial binding peptide of prion protein . ➥ 4
G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack,
UUUU, parallel, 4+0, 2(-P-P-P), coaxial interfaces:
5'/5'
|
|
2wcn
|
DNA |
NMR |
Nielsen JT, Arar K, Petersen M |
(2009) "Solution
Structure of a Locked Nucleic Acid Modified Quadruplex:
Introducing the V4 Folding Topology."
Angew.Chem.Int.Ed.Engl., 48,
3099. doi: 10.1002/ANIE.200806244.
|
Solution structure of an lna-modified quadruplex .
➥ 4 G-tetrads, 1 G4 helix, 1 G4
stem, UDUD, anti-parallel:chair, 2+2
|
|
352d
|
DNA |
X-ray (0.95 Å) |
Phillips K, Dauter Z, Murchie AI, Lilley DM, Luisi
B |
(1997) "The
crystal structure of a parallel-stranded guanine
tetraplex at 0.95 A resolution."
J.Mol.Biol., 273, 171-182.
doi: 10.1006/jmbi.1997.1292.
|
The crystal structure of a parallel-stranded
parallel-stranded guanine tetraplex at 0.95 angstrom
resolution . ➥ 4 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0
|
|
3cco
|
DNA |
X-ray (2.2 Å) |
Parkinson GN, Cuenca F, Neidle S |
(2008) "Topology
conservation and loop flexibility in quadruplex-drug
recognition: crystal structures of inter- and
intramolecular telomeric DNA quadruplex-drug
complexes." J.Mol.Biol.,
381, 1145-1156. doi: 10.1016/j.jmb.2008.06.022.
|
Structural adaptation and conservation in
quadruplex-drug recognition . ➥ 3
G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel,
4+0
|
|
3cdm
|
DNA |
X-ray (2.1 Å) |
Parkinson GN, Cuenca F, Neidle S |
(2008) "Topology
conservation and loop flexibility in quadruplex-drug
recognition: crystal structures of inter- and
intramolecular telomeric DNA quadruplex-drug
complexes." J.Mol.Biol.,
381, 1145-1156. doi: 10.1016/j.jmb.2008.06.022.
|
Structural adaptation and conservation in
quadruplex-drug recognition . ➥ 3
G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0,
3(-P-P-P)
|
|
3ce5
|
DNA |
X-ray (2.5 Å) |
Campbell NH, Parkinson GN, Reszka AP, Neidle S |
(2008) "Structural
basis of DNA quadruplex recognition by an acridine
drug." J.Am.Chem.Soc.,
130, 6722-6724. doi: 10.1021/ja8016973.
|
A bimolecular parallel-stranded human telomeric
quadruplex in complex with a 3,6,9-trisubstituted
acridine molecule braco19 . ➥
6 G-tetrads, 2 G4
helices, 2 G4 stems, UUUU, parallel, 4+0
|
|
3em2
|
DNA |
X-ray (2.3 Å) |
Campbell NH, Patel M, Tofa AB, Ghosh R, Parkinson GN,
Neidle S |
(2009) "Selectivity
in Ligand Recognition of G-Quadruplex Loops."
Biochemistry, 48, 1675-1680.
doi: 10.1021/bi802233v.
|
A bimolecular anti-parallel-stranded oxytricha nova
telomeric quadruplex in complex with a
3,6-disubstituted acridine bsu-6038 . ➥ 4
G-tetrads, 1 G4 helix, 1 G4 stem, UDDU,
anti-parallel:basket, 2+2
|
|
3eqw
|
DNA |
X-ray (2.2 Å) |
Campbell NH, Patel M, Tofa AB, Ghosh R, Parkinson GN,
Neidle S |
(2009) "Selectivity
in Ligand Recognition of G-Quadruplex Loops."
Biochemistry, 48, 1675-1680.
doi: 10.1021/bi802233v.
|
A bimolecular anti-parallel-stranded oxytricha nova
telomeric quadruplex in complex with a
3,6-disubstituted acridine bsu-6042 in small unit cell
. ➥ 4 G-tetrads, 1 G4 helix, 1 G4
stem, UDDU, anti-parallel:basket, 2+2
|
|
3eru
|
DNA |
X-ray (2.0 Å) |
Campbell NH, Patel M, Tofa AB, Ghosh R, Parkinson GN,
Neidle S |
(2009) "Selectivity
in Ligand Recognition of G-Quadruplex Loops."
Biochemistry, 48, 1675-1680.
doi: 10.1021/bi802233v.
|
A bimolecular anti-parallel-stranded oxytricha nova
telomeric quadruplex in complex with a
3,6-disubstituted acridine bsu-6045 . ➥ 4
G-tetrads, 1 G4 helix, 1 G4 stem, UDDU,
anti-parallel:basket, 2+2
|
|
3es0
|
DNA |
X-ray (2.2 Å) |
Campbell NH, Patel M, Tofa AB, Ghosh R, Parkinson GN,
Neidle S |
(2009) "Selectivity
in Ligand Recognition of G-Quadruplex Loops."
Biochemistry, 48, 1675-1680.
doi: 10.1021/bi802233v.
|
A bimolecular anti-parallel-stranded oxytricha nova
telomeric quadruplex in complex with a
3,6-disubstituted acridine bsu-6048 . ➥ 4
G-tetrads, 1 G4 helix, 1 G4 stem, UDDU,
anti-parallel:basket, 2+2
|
|
3et8
|
DNA |
X-ray (2.45 Å) |
Campbell NH, Patel M, Tofa AB, Ghosh R, Parkinson GN,
Neidle S |
(2009) "Selectivity
in Ligand Recognition of G-Quadruplex Loops."
Biochemistry, 48, 1675-1680.
doi: 10.1021/bi802233v.
|
A bimolecular anti-parallel-stranded oxytricha nova
telomeric quadruplex in complex with a
3,6-disubstituted acridine bsu-6054 . ➥ 4
G-tetrads, 1 G4 helix, 1 G4 stem, UDDU,
anti-parallel:basket, 2+2
|
|
3eui
|
DNA |
X-ray (2.2 Å) |
Campbell NH, Patel M, Tofa AB, Ghosh R, Parkinson GN,
Neidle S |
(2009) "Selectivity
in Ligand Recognition of G-Quadruplex Loops."
Biochemistry, 48, 1675-1680.
doi: 10.1021/bi802233v.
|
A bimolecular anti-parallel-stranded oxytricha nova
telomeric quadruplex in complex with a
3,6-disubstituted acridine bsu-6042 in a large unit
cell . ➥ 4 G-tetrads, 1 G4 helix, 1 G4
stem, UDDU, anti-parallel:basket, 2+2
|
|
3eum
|
DNA |
X-ray (1.78 Å) |
Campbell NH, Patel M, Tofa AB, Ghosh R, Parkinson GN,
Neidle S |
(2009) "Selectivity
in Ligand Recognition of G-Quadruplex Loops."
Biochemistry, 48, 1675-1680.
doi: 10.1021/bi802233v.
|
A bimolecular anti-parallel-stranded oxytricha nova
telomeric quadruplex in complex with a
3,6-disubstituted acridine bsu-6066 . ➥ 4
G-tetrads, 1 G4 helix, 1 G4 stem, UDDU,
anti-parallel:basket, 2+2
|
|
3ibk
|
RNA |
X-ray (2.2 Å) |
Collie GW, Haider SM, Neidle S, Parkinson GN |
(2010) "A
crystallographic and modelling study of a human
telomeric RNA (TERRA) quadruplex." Nucleic
Acids Res., 38, 5569-5580. doi:
10.1093/nar/gkq259.
|
Crystal structure of a telomeric RNA quadruplex .
➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0
|
|
3mij
|
RNA |
X-ray (2.6 Å) |
Collie GW, Sparapani S, Parkinson GN, Neidle S |
(2011) "Structural
basis of telomeric RNA quadruplex-acridine ligand
recognition." J.Am.Chem.Soc.,
133, 2721-2728. doi: 10.1021/ja109767y.
|
Crystal structure of a telomeric RNA g-quadruplex
complexed with an acridine-based ligand. . ➥ 3
G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel,
4+0
|
|
3nyp
|
DNA |
X-ray (1.179 Å) |
Campbell NH, Smith DL, Reszka AP, Neidle S, O'Hagan
D |
(2011) "Fluorine
in medicinal chemistry: beta-fluorination of peripheral
pyrrolidines attached to acridine ligands affects their
interactions with G-quadruplex DNA."
Org.Biomol.Chem., 9,
1328-1331. doi: 10.1039/c0ob00886a.
|
A bimolecular anti-parallel-stranded oxytricha nova
telomeric quadruplex in complex with a
3,6-disubstituted acridine ligand containing
bis-3-fluoropyrrolidine end side chains . ➥ 4
G-tetrads, 1 G4 helix, 1 G4 stem, UDDU,
anti-parallel:basket, 2+2
|
|
3nz7
|
DNA |
X-ray (1.1 Å) |
Campbell NH, Smith DL, Reszka AP, Neidle S, O'Hagan
D |
(2011) "Fluorine
in medicinal chemistry: beta-fluorination of peripheral
pyrrolidines attached to acridine ligands affects their
interactions with G-quadruplex DNA."
Org.Biomol.Chem., 9,
1328-1331. doi: 10.1039/c0ob00886a.
|
A bimolecular anti-parallel-stranded oxytricha nova
telomeric quadruplex in complex with a
3,6-disubstituted acridine ligand containing
bis-3-fluoropyrrolidine end side chains . ➥ 4
G-tetrads, 1 G4 helix, 1 G4 stem, UDDU,
anti-parallel:basket, 2+2
|
|
3qcr
|
DNA |
X-ray (3.2 Å) |
Collie GW, Sparapani S, Parkinson GN, Neidle S |
(2011) "Structural
basis of telomeric RNA quadruplex-acridine ligand
recognition." J.Am.Chem.Soc.,
133, 2721-2728. doi: 10.1021/ja109767y.
|
Incomplete structural model of a human telomeric DNA
quadruplex-acridine complex. . ➥ 3
G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel,
4+0
|
|
3qlp
|
hydrolase-hydrolase inhibitor-DNA |
X-ray (2.14 Å) |
Russo Krauss I, Merlino A, Giancola C, Randazzo A,
Mazzarella L, Sica F |
(2011) "Thrombin-aptamer
recognition: a revealed ambiguity." Nucleic
Acids Res., 39, 7858-7867. doi:
10.1093/nar/gkr522.
|
X-ray structure of the complex between human alpha
thrombin and a modified thrombin binding aptamer (mtba)
. ➥ 2 G-tetrads, 1 G4 helix, 1 G4
stem, DDUD, ---???---, 1+3, 2(+Lm+Lw+Ln)
|
|
3qsc
|
DNA |
X-ray (2.4 Å) |
Campbell NH, Karim NH, Parkinson GN, Gunaratnam M,
Petrucci V, Todd AK, Vilar R, Neidle S |
(2012) "Molecular
basis of structure-activity relationships between
salphen metal complexes and human telomeric DNA
quadruplexes." J.Med.Chem.,
55, 209-222. doi: 10.1021/jm201140v.
|
The first crystal structure of a human telomeric
g-quadruplex DNA bound to a metal-containing ligand (a
copper complex) . ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0
|
|
3qsf
|
DNA |
X-ray (2.4 Å) |
Campbell NH, Karim NH, Parkinson GN, Gunaratnam M,
Petrucci V, Todd AK, Vilar R, Neidle S |
(2012) "Molecular
basis of structure-activity relationships between
salphen metal complexes and human telomeric DNA
quadruplexes." J.Med.Chem.,
55, 209-222. doi: 10.1021/jm201140v.
|
The first crystal structure of a human telomeric
g-quadruplex DNA bound to a metal-containing ligand (a
nickel complex) . ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0
|
|
3qxr
|
DNA |
X-ray (1.62 Å) |
Wei D, Parkinson GN, Reszka AP, Neidle S |
(2012) "Crystal
structure of a c-kit promoter quadruplex reveals the
structural role of metal ions and water molecules in
maintaining loop conformation." Nucleic Acids
Res., 40, 4691-4700. doi:
10.1093/nar/gks023.
|
Crystal structure of the brominated ckit-1
proto-oncogene promoter quadruplex DNA . ➥ 3
G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0,
2(-PX+P)
|
|
3r6r
|
DNA-antibiotic |
X-ray (2.4 Å) |
Bazzicalupi C, Ferraroni M, Bilia AR, Scheggi F,
Gratteri P |
(2013) "The
crystal structure of human telomeric DNA complexed with
berberine: an interesting case of stacked ligand to
G-tetrad ratio higher than 1:1." Nucleic Acids
Res., 41, 632-638. doi: 10.1093/nar/gks1001.
|
Structure of the complex of an intramolecular human
telomeric DNA with berberine formed in k+ solution .
➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
3sc8
|
DNA |
X-ray (2.302 Å) |
Collie GW, Promontorio R, Hampel SM, Micco M, Neidle
S, Parkinson GN |
(2012) "Structural
basis for telomeric g-quadruplex targeting by
naphthalene diimide ligands."
J.Am.Chem.Soc., 134,
2723-2731. doi: 10.1021/ja2102423.
|
Crystal structure of an intramolecular human telomeric
DNA g-quadruplex bound by the naphthalene diimide
bmsg-sh-3 . ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
3t5e
|
DNA |
X-ray (2.1 Å) |
Collie GW, Promontorio R, Hampel SM, Micco M, Neidle
S, Parkinson GN |
(2012) "Structural
basis for telomeric g-quadruplex targeting by
naphthalene diimide ligands."
J.Am.Chem.Soc., 134,
2723-2731. doi: 10.1021/ja2102423.
|
Crystal structure of an intramolecular human telomeric
DNA g-quadruplex bound by the naphthalene diimide
bmsg-sh-4 . ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
3tvb
|
DNA-antibiotic |
X-ray (1.08 Å) |
Clark GR, Pytel PD, Squire CJ |
(2012) "The
high-resolution crystal structure of a parallel
intermolecular DNA G-4 quadruplex/drug complex
employing syn glycosyl linkages." Nucleic Acids
Res., 40, 5731-5738. doi:
10.1093/nar/gks193.
|
A highly symmetric DNA g-4 quadruplex-drug complex .
➥ 8 G-tetrads, 2 G4 helices, 2 G4
stems, UUUU, parallel, 4+0
|
|
3uyh
|
DNA |
X-ray (1.95 Å) |
Micco M, Collie GW, Dale AG, Ohnmacht SA, Pazitna I,
Gunaratnam M, Reszka AP, Neidle S |
(2013) "Structure-based
design and evaluation of naphthalene diimide
g-quadruplex ligands as telomere targeting agents in
pancreatic cancer cells." J.Med.Chem.,
56, 2959-2974. doi: 10.1021/jm301899y.
|
Crystal structure of an intramolecular human telomeric
DNA g-quadruplex bound by the naphthalene diimide
compound, mm41 . ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
4da3
|
DNA |
X-ray (2.4 Å) |
Micco M, Collie GW, Dale AG, Ohnmacht SA, Pazitna I,
Gunaratnam M, Reszka AP, Neidle S |
(2013) "Structure-based
design and evaluation of naphthalene diimide
g-quadruplex ligands as telomere targeting agents in
pancreatic cancer cells." J.Med.Chem.,
56, 2959-2974. doi: 10.1021/jm301899y.
|
Crystal structure of an intramolecular human telomeric
DNA g-quadruplex 21-mer bound by the naphthalene
diimide compound mm41. . ➥
3 G-tetrads, 1 G4 helix,
1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
4daq
|
DNA |
X-ray (2.754 Å) |
Micco M, Collie GW, Dale AG, Ohnmacht SA, Pazitna I,
Gunaratnam M, Reszka AP, Neidle S |
(2013) "Structure-based
design and evaluation of naphthalene diimide
g-quadruplex ligands as telomere targeting agents in
pancreatic cancer cells." J.Med.Chem.,
56, 2959-2974. doi: 10.1021/jm301899y.
|
Crystal structure of an intramolecular human telomeric
DNA g-quadruplex 21-mer bound by the naphthalene
diimide compound bmsg-sh-3 . ➥
3 G-tetrads, 1 G4 helix,
1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
4dih
|
hydrolase-hydrolase inhibitor-DNA |
X-ray (1.8 Å) |
Russo Krauss I, Merlino A, Randazzo A, Novellino E,
Mazzarella L, Sica F |
(2012) "High-resolution
structures of two complexes between thrombin and
thrombin-binding aptamer shed light on the role of
cations in the aptamer inhibitory activity."
Nucleic Acids Res., 40,
8119-8128. doi: 10.1093/nar/gks512.
|
X-ray structure of the complex between human alpha
thrombin and thrombin binding aptamer in the presence
of sodium ions . ➥ 2 G-tetrads, 1 G4 helix, 1 G4
stem, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
|
|
4dii
|
hydrolase-hydrolase inhibitor-DNA |
X-ray (2.05 Å) |
Russo Krauss I, Merlino A, Randazzo A, Novellino E,
Mazzarella L, Sica F |
(2012) "High-resolution
structures of two complexes between thrombin and
thrombin-binding aptamer shed light on the role of
cations in the aptamer inhibitory activity."
Nucleic Acids Res., 40,
8119-8128. doi: 10.1093/nar/gks512.
|
X-ray structure of the complex between human alpha
thrombin and thrombin binding aptamer in the presence
of potassium ions . ➥ 2 G-tetrads, 1 G4 helix, 1 G4
stem, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
|
|
4fxm
|
DNA |
X-ray (1.651 Å) |
Nicoludis JM, Miller ST, Jeffrey PD, Barrett SP,
Rablen PR, Lawton TJ, Yatsunyk LA |
(2012) "Optimized
End-Stacking Provides Specificity of N-Methyl
Mesoporphyrin IX for Human Telomeric G-Quadruplex
DNA." J.Am.Chem.Soc.,
134, 20446-20456. doi: 10.1021/ja3088746.
|
Crystal structure of the complex of a human telomeric
repeat g-quadruplex and n-methyl mesoporphyrin ix
(p21212) . ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
4g0f
|
DNA |
X-ray (2.15 Å) |
Nicoludis JM, Miller ST, Jeffrey PD, Barrett SP,
Rablen PR, Lawton TJ, Yatsunyk LA |
(2012) "Optimized
End-Stacking Provides Specificity of N-Methyl
Mesoporphyrin IX for Human Telomeric G-Quadruplex
DNA." J.Am.Chem.Soc.,
134, 20446-20456. doi: 10.1021/ja3088746.
|
Crystal structure of the complex of a human telomeric
repeat g-quadruplex and n-methyl mesoporphyrin ix (p6)
. ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
4h29
|
DNA |
X-ray (1.991 Å) |
Wei D, Todd AK, Zloh M, Gunaratnam M, Parkinson GN,
Neidle S |
(2013) "Crystal
Structure of a Promoter Sequence in the B-raf Gene
Reveals an Intertwined Dimer Quadruplex."
J.Am.Chem.Soc., 135,
19319-19329. doi: 10.1021/ja4101358.
|
B-raf dimer DNA quadruplex . ➥
7 G-tetrads, 1 G4 helix,
3 G4 stems, 1 G4 coaxial stack, UDUD,
anti-parallel:chair, 2+2; UUUU, parallel, 4+0, coaxial
interfaces: mixed; 3'/5'
|
|
4i7y
|
hydrolase-hydrolase inhibitor-DNA |
X-ray (2.4 Å) |
Russo Krauss I, Pica A, Merlino A, Mazzarella L, Sica
F |
(2013) "Duplex-quadruplex
motifs in a peculiar structural organization
cooperatively contribute to thrombin binding of a DNA
aptamer." Acta Crystallogr.,Sect.D,
69, 2403-2411. doi: 10.1107/S0907444913022269.
|
Crystal structure of human alpha thrombin in complex
with a 27-mer aptamer bound to exosite ii .
➥ 1 G-tetrad
|
|
4kzd
|
immune system-RNA |
X-ray (2.186 Å) |
Huang H, Suslov NB, Li NS, Shelke SA, Evans ME,
Koldobskaya Y, Rice PA, Piccirilli JA |
(2014) "A
G-quadruplex-containing RNA activates fluorescence in a
GFP-like fluorophore." Nat.Chem.Biol.,
10, 686-691. doi: 10.1038/nchembio.1561.
|
Crystal structure of an RNA aptamer in complex with
fluorophore and fab . ➥
2 G-tetrads, 1 G4 helix,
1 G4 stem, UUDD, anti-parallel:basket2, 2+2,
2(-PD+P)
|
|
4kze
|
immune system-RNA |
X-ray (2.404 Å) |
Huang H, Suslov NB, Li NS, Shelke SA, Evans ME,
Koldobskaya Y, Rice PA, Piccirilli JA |
(2014) "A
G-quadruplex-containing RNA activates fluorescence in a
GFP-like fluorophore." Nat.Chem.Biol.,
10, 686-691. doi: 10.1038/nchembio.1561.
|
Crystal structure of an RNA aptamer in complex with fab
. ➥ 2 G-tetrads, 1 G4 helix, 1 G4
stem, UUDD, anti-parallel:basket2, 2+2, 2(-PD+P)
|
|
4l0a
|
DNA, RNA |
X-ray (1.7 Å) |
Russo Krauss I, Parkinson GN, Merlino A, Mattia CA,
Randazzo A, Novellino E, Mazzarella L, Sica F |
(2014) "A
regular thymine tetrad and a peculiar supramolecular
assembly in the first crystal structure of an all-LNA
G-quadruplex." Acta Crystallogr.,Sect.D,
70, 362-370. doi: 10.1107/S1399004713028095.
|
X-ray structure of an all lna quadruplex . ➥ 3
G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel,
4+0
|
|
4lz1
|
hydrolase-hydrolase inhibitor-DNA |
X-ray (1.65 Å) |
Pica A, Russo Krauss I, Merlino A, Nagatoishi S,
Sugimoto N, Sica F |
(2013) "Dissecting
the contribution of thrombin exosite I in the
recognition of thrombin binding aptamer." Febs
J., 280, 6581-6588. doi: 10.1111/febs.12561.
|
X-ray structure of the complex between human thrombin
and the tba deletion mutant lacking thymine 12
nucleobase . ➥ 2 G-tetrads, 1 G4 helix, 1 G4
stem, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
|
|
4lz4
|
hydrolase-hydrolase inhibitor-DNA |
X-ray (2.56 Å) |
Pica A, Russo Krauss I, Merlino A, Nagatoishi S,
Sugimoto N, Sica F |
(2013) "Dissecting
the contribution of thrombin exosite I in the
recognition of thrombin binding aptamer." Febs
J., 280, 6581-6588. doi: 10.1111/febs.12561.
|
X-ray structure of the complex between human thrombin
and the tba deletion mutant lacking thymine 3
nucleobase . ➥ 2 G-tetrads, 1 G4 helix, 1 G4
stem, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
|
|
4ni7
|
cytokine-DNA |
X-ray (2.4 Å) |
Gelinas AD, Davies DR, Edwards TE, Rohloff JC, Carter
JD, Zhang C, Gupta S, Ishikawa Y, Hirota M, Nakaishi Y,
Jarvis TC, Janjic N |
(2014) "Crystal
structure of interleukin-6 in complex with a modified
nucleic Acid ligand." J.Biol.Chem.,
289, 8720-8734. doi: 10.1074/jbc.M113.532697.
|
Crystal structure of human interleukin 6 in complex
with a modified nucleotide aptamer (somamer sl1025) .
➥ 2 G-tetrads, 1 G4 helix, 1 G4
stem, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw)
|
|
4ni9
|
cytokine-DNA |
X-ray (2.55 Å) |
Gelinas AD, Davies DR, Edwards TE, Rohloff JC, Carter
JD, Zhang C, Gupta S, Ishikawa Y, Hirota M, Nakaishi Y,
Jarvis TC, Janjic N |
(2014) "Crystal
structure of interleukin-6 in complex with a modified
nucleic Acid ligand." J.Biol.Chem.,
289, 8720-8734. doi: 10.1074/jbc.M113.532697.
|
Crystal structure of human interleukin 6 in complex
with a modified nucleotide aptamer (somamer sl1025),
form 2 . ➥ 4 G-tetrads, 2 G4 helices, 2 G4
stems, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
|
|
4p1d
|
DNA |
X-ray (1.55 Å) |
Ferraroni M, Bazzicalupi C, Gratteri P, Bilia AR,
Sissi C |
"Crystal Structure of the complex of a bimolecular
human telomeric DNA with Coptisine." |
Structure of the complex of a bimolecular human
telomeric DNA with coptisine . ➥ 3
G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel,
4+0
|
|
4q9q
|
RNA |
X-ray (2.45 Å) |
Huang H, Suslov NB, Li NS, Shelke SA, Evans ME,
Koldobskaya Y, Rice PA, Piccirilli JA |
(2014) "A
G-quadruplex-containing RNA activates fluorescence in a
GFP-like fluorophore." Nat.Chem.Biol.,
10, 686-691. doi: 10.1038/nchembio.1561.
|
Crystal structure of an RNA aptamer bound to
bromo-ligand analog in complex with fab . ➥ 2
G-tetrads, 1 G4 helix, 1 G4 stem, UUDD,
anti-parallel:basket2, 2+2, 2(-PD+P)
|
|
4q9r
|
RNA-immune system |
X-ray (3.12 Å) |
Huang H, Suslov NB, Li NS, Shelke SA, Evans ME,
Koldobskaya Y, Rice PA, Piccirilli JA |
(2014) "A
G-quadruplex-containing RNA activates fluorescence in a
GFP-like fluorophore." Nat.Chem.Biol.,
10, 686-691. doi: 10.1038/nchembio.1561.
|
Crystal structure of an RNA aptamer bound to
trifluoroethyl-ligand analog in complex with fab .
➥ 2 G-tetrads, 1 G4 helix, 1 G4
stem, UUDD, anti-parallel:basket2, 2+2, 2(-PD+P)
|
|
4r44
|
DNA |
X-ray (2.695 Å) |
Mandal PK, Collie GW, Kauffmann B, Huc I |
(2014) "Racemic
DNA crystallography."
Angew.Chem.Int.Ed.Engl., 53,
14424-14427. doi: 10.1002/anie.201409014.
|
Racemic crystal structure of a tetramolecular DNA
g-quadruplex . ➥ 8 G-tetrads, 1 G4 helix, 2 G4
stems, 1 G4 coaxial stack, UUUU, parallel, 4+0, coaxial
interfaces: 5'/5'
|
|
4r45
|
DNA |
X-ray (1.9 Å) |
Mandal PK, Collie GW, Kauffmann B, Huc I |
(2014) "Racemic
DNA crystallography."
Angew.Chem.Int.Ed.Engl., 53,
14424-14427. doi: 10.1002/anie.201409014.
|
Racemic crystal structure of a bimolecular DNA
g-quadruplex (p-1) . ➥
4 G-tetrads, 1 G4 helix,
1 G4 stem, UDDU, anti-parallel:basket, 2+2
|
|
4r47
|
DNA |
X-ray (1.85 Å) |
Mandal PK, Collie GW, Kauffmann B, Huc I |
(2014) "Racemic
DNA crystallography."
Angew.Chem.Int.Ed.Engl., 53,
14424-14427. doi: 10.1002/anie.201409014.
|
Racemic crystal structure of a bimolecular DNA
g-quadruplex (p21-n) . ➥
4 G-tetrads, 1 G4 helix,
1 G4 stem, UDDU, anti-parallel:basket, 2+2
|
|
4rj1
|
RNA |
X-ray (0.92 Å) |
Fyfe AC, Dunten PW, Martick MM, Scott WG |
(2015) "Structural
Variations and Solvent Structure of r(UGGGGU)
Quadruplexes Stabilized by Sr(2+) Ions."
J.Mol.Biol., 427, 2205-2219.
doi: 10.1016/j.jmb.2015.03.022.
|
Structural variations and solvent structure of uggggu
quadruplexes stabilized by sr2+ ions . ➥ 8
G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack,
UUUU, parallel, 4+0, coaxial interfaces: 5'/5'
|
|
4rkv
|
RNA |
X-ray (0.88 Å) |
Fyfe AC, Dunten PW, Martick MM, Scott WG |
(2015) "Structural
Variations and Solvent Structure of r(UGGGGU)
Quadruplexes Stabilized by Sr(2+) Ions."
J.Mol.Biol., 427, 2205-2219.
doi: 10.1016/j.jmb.2015.03.022.
|
Structural variations and solvent structure of uggggu
quadruplexes stabilized by sr2+ ions . ➥ 8
G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack,
UUUU, parallel, 4+0, coaxial interfaces: 5'/5'
|
|
4rne
|
RNA |
X-ray (1.01 Å) |
Fyfe AC, Dunten PW, Martick MM, Scott WG |
(2015) "Structural
Variations and Solvent Structure of r(UGGGGU)
Quadruplexes Stabilized by Sr(2+) Ions."
J.Mol.Biol., 427, 2205-2219.
doi: 10.1016/j.jmb.2015.03.022.
|
Structural variations and solvent structure of uggggu
quadruplexes stabilized by sr2+ ions . ➥ 8
G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack,
UUUU, parallel, 4+0, coaxial interfaces: 5'/5'
|
|
4ts0
|
RNA |
X-ray (2.8 Å) |
Warner KD, Chen MC, Song W, Strack RL, Thorn A,
Jaffrey SR, Ferre-D'Amare AR |
(2014) "Structural
basis for activity of highly efficient RNA mimics of
green fluorescent protein."
Nat.Struct.Mol.Biol., 21,
658-663. doi: 10.1038/nsmb.2865.
|
Crystal structure of the spinach RNA aptamer in complex
with dfhbi, barium ions . ➥
2 G-tetrads, 1 G4 helix,
1 G4 stem, UUDD, anti-parallel:basket2, 2+2
|
|
4ts2
|
RNA |
X-ray (2.884 Å) |
Warner KD, Chen MC, Song W, Strack RL, Thorn A,
Jaffrey SR, Ferre-D'Amare AR |
(2014) "Structural
basis for activity of highly efficient RNA mimics of
green fluorescent protein."
Nat.Struct.Mol.Biol., 21,
658-663. doi: 10.1038/nsmb.2865.
|
Crystal structure of the spinach RNA aptamer in complex
with dfhbi, magnesium ions . ➥
2 G-tetrads, 1 G4 helix,
1 G4 stem, UUDD, anti-parallel:basket2, 2+2
|
|
4u5m
|
DNA |
X-ray (1.5 Å) |
Chung WJ, Heddi B, Schmitt E, Lim KW, Mechulam Y,
Phan AT |
(2015) "Structure
of a left-handed DNA G-quadruplex."
Proc.Natl.Acad.Sci.USA, 112,
2729-2733. doi: 10.1073/pnas.1418718112.
|
Structure of a left-handed DNA g-quadruplex .
➥ 4 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 2(+P+P+P), negative
twist
|
|
4u92
|
DNA |
X-ray (1.5 Å) |
Zhang D, Huang T, Lukeman PS, Paukstelis PJ |
(2014) "Crystal
structure of a DNA/Ba2+ G-quadruplex containing a
water-mediated C-tetrad." Nucleic Acids
Res., 42, 13422-13429. doi:
10.1093/nar/gku1122.
|
Crystal structure of a DNA-ba2+ g-quadruplex containing
a water-mediated c-tetrad . ➥
8 G-tetrads, 1 G4 helix,
2 G4 stems, 1 G4 coaxial stack, UUUU, parallel, 4+0,
coaxial interfaces: 3'/3'
|
|
4wb2
|
DNA-RNA hybrid |
X-ray (1.8 Å) |
Yatime L, Maasch C, Hoehlig K, Klussmann S, Andersen
GR, Vater A |
(2015) "Structural
basis for the targeting of complement anaphylatoxin C5a
using a mixed L-RNA/L-DNA aptamer." Nat
Commun, 6, 6481. doi: 10.1038/ncomms7481.
|
Crystal structure of the mirror-image l-RNA-l-DNA
aptamer nox-d20 in complex with mouse c5a complement
anaphylatoxin . ➥ 2 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 2(-P-P-P)
|
|
4wb3
|
DNA-RNA hybrid |
X-ray (2.0 Å) |
Yatime L, Maasch C, Hoehlig K, Klussmann S, Andersen
GR, Vater A |
(2015) "Structural
basis for the targeting of complement anaphylatoxin C5a
using a mixed L-RNA/L-DNA aptamer." Nat
Commun, 6, 6481. doi: 10.1038/ncomms7481.
|
Crystal structure of the mirror-image l-RNA-l-DNA
aptamer nox-d20 in complex with mouse c5a-desarg
complement anaphylatoxin . ➥
2 G-tetrads, 1 G4 helix,
1 G4 stem, UUUU, parallel, 4+0, 2(-P-P-P)
|
|
4wo2
|
DNA |
X-ray (1.82 Å) |
Wei D, Parkinson GN, Neidle S |
"CRYSTAL STRUCTURE OF HUMAN NATIVE CKIT-1
PROTO-ONCOGENE PROMOTER QUADRUPLEX DNA." |
Crystal structure of human native ckit proto-oncogene
promoter quadruplex DNA . ➥
6 G-tetrads, 1 G4 helix,
2 G4 stems, 1 G4 coaxial stack, UUUU, parallel, 4+0,
2(-PX+P), coaxial interfaces: 5'/5'-SEPARATED
|
|
4wo3
|
DNA |
X-ray (2.73 Å) |
Wei D, Neidle S |
"THE SECOND C-KIT1 DNA QUADRUPLEX CRYSTAL
STRUCTURE." |
The second c-kit DNA quadruplex crystal structure .
➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 2(-PX+P)
|
|
4xk0
|
RNA |
X-ray (1.08 Å) |
Chen MC, Murat P, Abecassis K, Ferre-D'Amare AR,
Balasubramanian S |
(2015) "Insights
into the mechanism of a G-quadruplex-unwinding DEAH-box
helicase." Nucleic Acids Res.,
43, 2223-2231. doi: 10.1093/nar/gkv051.
|
Crystal structure of a tetramolecular RNA g-quadruplex
in potassium . ➥ 8 G-tetrads, 1 G4 helix, 2 G4
stems, 1 G4 coaxial stack, UUUU, parallel, 4+0, coaxial
interfaces: 5'/5'
|
|
5bjo
|
RNA |
X-ray (2.35 Å) |
Warner KD, Sjekloca L, Song W, Filonov GS, Jaffrey
SR, Ferre-D'Amare AR |
(2017) "A
homodimer interface without base pairs in an RNA mimic
of red fluorescent protein." Nat. Chem.
Biol., 13, 1195-1201. doi:
10.1038/nchembio.2475.
|
Crystal structure of the corn RNA aptamer in complex
with dfho, site-specific 5-iodo-u . ➥ 4
G-tetrads, 2 G4 helices, 2 G4 stems, UUUU, parallel,
4+0, 2(-P-P-P)
|
|
5bjp
|
RNA |
X-ray (2.51 Å) |
Warner KD, Sjekloca L, Song W, Filonov GS, Jaffrey
SR, Ferre-D'Amare AR |
(2017) "A
homodimer interface without base pairs in an RNA mimic
of red fluorescent protein." Nat. Chem.
Biol., 13, 1195-1201. doi:
10.1038/nchembio.2475.
|
Crystal structure of the corn RNA aptamer in complex
with dfho, iridium hexammine soak . ➥ 4
G-tetrads, 2 G4 helices, 2 G4 stems, UUUU, parallel,
4+0, 2(-P-P-P)
|
|
5ccw
|
drug-DNA |
X-ray (1.89 Å) |
Bazzicalupi C, Ferraroni M, Papi F, Massai L,
Bertrand B, Messori L, Gratteri P, Casini A |
(2016) "Determinants
for Tight and Selective Binding of a Medicinal
Dicarbene Gold(I) Complex to a Telomeric DNA
G-Quadruplex: a Joint ESI MS and XRD
Investigation." Angew.Chem.Int.Ed.Engl.,
55, 4256-4259. doi: 10.1002/anie.201511999.
|
Structure of the complex of a human telomeric DNA with
au(caffein-2-ylidene)2 . ➥
3 G-tetrads, 1 G4 helix,
1 G4 stem, UUUU, parallel, 4+0, 3(-P-P)
|
|
5cdb
|
DNA |
X-ray (1.7 Å) |
Ferraroni M, Bazzicalupi C, Papi F, Fiorillo G,
Guaman-Ortiz LM, Nocentini A, Scovassi AI, Lombardi P,
Gratteri P |
(2016) "Solution
and Solid-State Analysis of Binding of 13-Substituted
Berberine Analogues to Human Telomeric
G-quadruplexes." Chem Asian J,
11, 1107-1115. doi: 10.1002/asia.201600116.
|
Structure of the complex of a bimolecular human
telomeric DNA with a 13-diphenylalkyl berberine
derivative . ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0
|
|
5cmx
|
hydrolase |
X-ray (2.98 Å) |
Russo Krauss I, Spiridonova V, Pica A, Napolitano V,
Sica F |
(2016) "Different
duplex/quadruplex junctions determine the properties of
anti-thrombin aptamers with mixed folding."
Nucleic Acids Res., 44,
983-991. doi: 10.1093/nar/gkv1384.
|
X-ray structure of the complex between human alpha
thrombin and a duplex-quadruplex 31-mer DNA aptamer .
➥ 2 G-tetrads, 1 G4 helix, 1 G4
stem, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
|
|
5de5
|
RNA binding protein-RNA |
X-ray (3.0 Å) |
Vasilyev N, Polonskaia A, Darnell JC, Darnell RB,
Patel DJ, Serganov A |
(2015) "Crystal
structure reveals specific recognition of a
G-quadruplex RNA by a beta-turn in the RGG motif of
FMRP." Proc.Natl.Acad.Sci.USA,
112, E5391-E5400. doi: 10.1073/pnas.1515737112.
|
Crystal structure of the complex between human fmrp rgg
motif and g-quadruplex RNA. . ➥ 3
G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0,
2(-P-P-P)
|
|
5de8
|
RNA binding protein-RNA |
X-ray (3.1 Å) |
Vasilyev N, Polonskaia A, Darnell JC, Darnell RB,
Patel DJ, Serganov A |
(2015) "Crystal
structure reveals specific recognition of a
G-quadruplex RNA by a beta-turn in the RGG motif of
FMRP." Proc.Natl.Acad.Sci.USA,
112, E5391-E5400. doi: 10.1073/pnas.1515737112.
|
Crystal structure of the complex between human fmrp rgg
motif and g-quadruplex RNA, iridium hexammine bound
form. . ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 2(-P-P-P)
|
|
5dea
|
RNA binding protein-RNA |
X-ray (2.8 Å) |
Vasilyev N, Polonskaia A, Darnell JC, Darnell RB,
Patel DJ, Serganov A |
(2015) "Crystal
structure reveals specific recognition of a
G-quadruplex RNA by a beta-turn in the RGG motif of
FMRP." Proc.Natl.Acad.Sci.USA,
112, E5391-E5400. doi: 10.1073/pnas.1515737112.
|
Crystal structure of the complex between human fmrp rgg
motif and g-quadruplex RNA, cesium bound form. .
➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 2(-P-P-P)
|
|
5dww
|
DNA |
X-ray (2.79 Å) |
Russo Krauss I, Ramaswamy S, Neidle S, Haider S,
Parkinson GN |
(2016) "Structural
Insights into the Quadruplex-Duplex 3' Interface Formed
from a Telomeric Repeat: A Potential Molecular
Target." J.Am.Chem.Soc.,
138, 1226-1233. doi: 10.1021/jacs.5b10492.
|
Structural insights into the quadruplex-duplex 3'
interface formed from a telomeric repeat - ttloop .
➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
5dwx
|
DNA |
X-ray (2.71 Å) |
Russo Krauss I, Ramaswamy S, Neidle S, Haider S,
Parkinson GN |
(2016) "Structural
Insights into the Quadruplex-Duplex 3' Interface Formed
from a Telomeric Repeat: A Potential Molecular
Target." J.Am.Chem.Soc.,
138, 1226-1233. doi: 10.1021/jacs.5b10492.
|
Structural insights into the quadruplex-duplex 3'
interface formed from a telomeric repeat - tloop .
➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
5ew1
|
protein-DNA |
X-ray (2.95 Å) |
Pica A, Russo Krauss I, Parente V, Tateishi-Karimata
H, Nagatoishi S, Tsumoto K, Sugimoto N, Sica F |
(2017) "Through-bond
effects in the ternary complexes of thrombin sandwiched
by two DNA aptamers." Nucleic Acids Res.,
45, 461-469. doi: 10.1093/nar/gkw1113.
|
Human thrombin sandwiched between two DNA aptamers:
hd22 and hd1-deltat3 . ➥
3 G-tetrads, 1 G4 helix,
1 G4 stem, UDUD, anti-parallel:chair, 2+2,
2(+Ln+Lw+Ln)
|
|
5ew2
|
protein-DNA |
X-ray (3.59 Å) |
Pica A, Russo Krauss I, Parente V, Tateishi-Karimata
H, Nagatoishi S, Tsumoto K, Sugimoto N, Sica F |
(2017) "Through-bond
effects in the ternary complexes of thrombin sandwiched
by two DNA aptamers." Nucleic Acids Res.,
45, 461-469. doi: 10.1093/nar/gkw1113.
|
Human thrombin sandwiched between two DNA aptamers:
hd22 and hd1-deltat12 . ➥
3 G-tetrads, 1 G4 helix,
1 G4 stem, UDUD, anti-parallel:chair, 2+2,
2(+Ln+Lw+Ln)
|
|
5hix
|
DNA |
X-ray (2.48 Å) |
Mandal PK, Baptiste B, Langlois d'Estaintot B,
Kauffmann B, Huc I |
(2016) "Multivalent
Interactions between an Aromatic Helical Foldamer and a
DNA G-Quadruplex in the Solid State."
Chembiochem, 17, 1911-1914.
doi: 10.1002/cbic.201600281.
|
Cocrystal structure of an anti-parallel DNA
g-quadruplex and a tetra-quinoline foldamer .
➥ 4 G-tetrads, 1 G4 helix, 1 G4
stem, UDDU, anti-parallel:basket, 2+2
|
|
5i2v
|
DNA |
NMR |
Kerkour A, Marquevielle J, Ivashchenko S, Yatsunyk
LA, Mergny JL, Salgado GF |
(2017) "High-resolution
three-dimensional NMR structure of the KRAS
proto-oncogene promoter reveals key features of a
G-quadruplex involved in transcriptional
regulation." J. Biol. Chem.,
292, 8082-8091. doi: 10.1074/jbc.M117.781906.
|
NMR structure of a new g-quadruplex forming sequence
within the kras proto-oncogene promoter region .
➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
5j05
|
DNA |
NMR |
Dvorkin SA, Karsisiotis AI, Webba da Silva M |
(2018) "Encoding
canonical DNA quadruplex structure." Sci
Adv, 4, eaat3007. doi: 10.1126/sciadv.aat3007.
|
Diy g-quadruplexes: solution structure of
d(gggtttgggttttgggaggg) in sodium . ➥ 3
G-tetrads, 1 G4 helix, 1 G4 stem, UDDU,
anti-parallel:basket, 2+2, 3(-LwD+Ln)
|
|
5j4p
|
DNA |
NMR |
Dvorkin SA, Karsisiotis AI, Webba da Silva M |
(2018) "Encoding
canonical DNA quadruplex structure." Sci
Adv, 4, eaat3007. doi: 10.1126/sciadv.aat3007.
|
Diy g-quadruplexes: solution structure of
d(ggtttggttttggtttgg) in sodium . ➥ 2
G-tetrads, 1 G4 helix, 1 G4 stem, UDDU,
anti-parallel:basket, 2+2, 2(-LwD+Ln)
|
|
5j4w
|
DNA |
NMR |
Dvorkin SA, Karsisiotis AI, Webba da Silva M |
(2018) "Encoding
canonical DNA quadruplex structure." Sci
Adv, 4, eaat3007. doi: 10.1126/sciadv.aat3007.
|
Diy g-quadruplexes: solution structure of
d(ggtttggttttggttgg) in sodium . ➥ 2
G-tetrads, 1 G4 helix, 1 G4 stem, UDDU,
anti-parallel:basket, 2+2, 2(-LwD+Ln)
|
|
5j6u
|
DNA |
NMR |
Dvorkin SA, Karsisiotis AI, Webba da Silva M |
(2018) "Encoding
canonical DNA quadruplex structure." Sci
Adv, 4, eaat3007. doi: 10.1126/sciadv.aat3007.
|
Diy g-quadruplexes: solution structure of
d(ggggtttggggttttggggaagggg) in sodium . ➥ 4
G-tetrads, 1 G4 helix, 1 G4 stem, UDDU,
anti-parallel:basket, 2+2, 4(-LwD+Ln)
|
|
5lig
|
DNA |
NMR |
Kotar A, Wang B, Shivalingam A, Gonzalez-Garcia J,
Vilar R, Plavec J |
(2016) "NMR
Structure of a Triangulenium-Based Long-Lived
Fluorescence Probe Bound to a G-Quadruplex."
Angew.Chem.Int.Ed.Engl., 55,
12508-12511. doi: 10.1002/anie.201606877.
|
G-quadruplex formed at the 5'-end of nheiii_1 element
in human c-myc promoter bound to triangulenium based
fluorescence probe daota-m2 . ➥ 3
G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0,
3(-P-P-P)
|
|
5lqg
|
DNA |
NMR |
Galer P, Wang B, Sket P, Plavec J |
(2016) "Reversible
pH Switch of Two-Quartet G-Quadruplexes Formed by Human
Telomere." Angew.Chem.Int.Ed.Engl.,
55, 1993-1997. doi: 10.1002/anie.201507569.
|
A two-quartet g-quadruplex formed by human telomere in
kcl solution at neutral ph . ➥
2 G-tetrads, 1 G4 helix,
1 G4 stem, UDDU, anti-parallel:basket, 2+2,
2(-LwD+Ln)
|
|
5lqh
|
DNA |
NMR |
Galer P, Wang B, Sket P, Plavec J |
(2016) "Reversible
pH Switch of Two-Quartet G-Quadruplexes Formed by Human
Telomere." Angew.Chem.Int.Ed.Engl.,
55, 1993-1997. doi: 10.1002/anie.201507569.
|
A two-quartet g-quadruplex formed by human telomere in
kcl solution at ph 5.0 . ➥
2 G-tetrads, 1 G4 helix,
1 G4 stem, UUDD, anti-parallel:basket2, 2+2,
2(+LnD-Lw)
|
|
5ls8
|
DNA |
X-ray (1.78 Å) |
McQuaid K, Abell H, Gurung SP, Allan DR, Winter G,
Sorensen T, Cardin DJ, Brazier JA, Cardin CJ, Hall
JP |
(2019) "Structural
Studies Reveal Enantiospecific Recognition of a DNA
G-Quadruplex by a Ruthenium Polypyridyl Complex."
Angew.Chem.Int.Ed.Engl., 58,
9881-9885. doi: 10.1002/anie.201814502.
|
Light-activated ruthenium complex bound to a DNA
quadruplex . ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UDUD, anti-parallel:chair, 2+2
|
|
5m2l
|
DNA |
NMR |
Kocman V, Plavec J |
(2017) "Tetrahelical
structural family adopted by AGCGA-rich regulatory DNA
regions." Nat Commun, 8,
15355. doi: 10.1038/ncomms15355.
|
Structure of DNA tetrameric agcga-quadruplex adopted by
15-mer d(gcgagggagcgaggg), vk34, oligonucleotide found
in regulatory region of the plekhg3 human gene .
➥ 2 G-tetrads
|
|
5mbr
|
DNA |
NMR |
Dickerhoff J, Haase L, Langel W, Weisz K |
(2017) "Tracing
Effects of Fluorine Substitutions on G-Quadruplex
Conformational Changes." ACS Chem. Biol.,
12, 1308-1315. doi: 10.1021/acschembio.6b01096.
|
Quadruplex with flipped tetrad formed by a human
telomeric sequence . ➥
3 G-tetrads, 1 G4 helix,
1 G4 stem, UUDU, hybrid1, 3+1, 3(-P-Lw-Ln)
|
|
5mcr
|
DNA |
NMR |
Dickerhoff J, Haase L, Langel W, Weisz K |
(2017) "Tracing
Effects of Fluorine Substitutions on G-Quadruplex
Conformational Changes." ACS Chem. Biol.,
12, 1308-1315. doi: 10.1021/acschembio.6b01096.
|
Quadruplex with flipped tetrad formed by an artificial
sequence . ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUD, hybrid2, 3+1, 3(-PD+Lw)
|
|
5mjx
|
DNA |
NMR |
Lietard J, Abou Assi H, Gomez-Pinto I, Gonzalez C,
Somoza MM, Damha MJ |
(2017) "Mapping
the affinity landscape of Thrombin-binding aptamers on
2 F-ANA/DNA chimeric G-Quadruplex microarrays."
Nucleic Acids Res., 45,
1619-1632. doi: 10.1093/nar/gkw1357.
|
2'f-ana-DNA chimeric tba quadruplex structure .
➥ 2 G-tetrads, 1 G4 helix, 1 G4
stem, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
|
|
5mta
|
DNA |
NMR |
Juribasic Kulcsar M, Gabelica V, Plavec J |
(2024) "Solution-State
Structure of a Long-Loop G-Quadruplex Formed Within
Promoters of Plasmodium falciparum B var Genes."
Chemistry, 30, e202401190.
doi: 10.1002/chem.202401190.
|
G-quadruplex formed within promoters of plasmodium
falciparum b var genes . ➥
3 G-tetrads, 1 G4 helix,
1 G4 stem, UUUD, hybrid2, 3+1, 3(-PD+Lw)
|
|
5mtg
|
DNA |
NMR |
Juribasic Kulcsar M, Gabelica V, Plavec J |
(2024) "Solution-State
Structure of a Long-Loop G-Quadruplex Formed Within
Promoters of Plasmodium falciparum B var Genes."
Chemistry, 30, e202401190.
doi: 10.1002/chem.202401190.
|
G-quadruplex formed within promoters of plasmodium
falciparum b var genes - form i . ➥ 3
G-tetrads, 1 G4 helix, 1 G4 stem, UUUD, hybrid2, 3+1,
3(-PD+Lw)
|
|
5mvb
|
DNA |
NMR |
Wirmer-Bartoschek J, Bendel LE, Jonker HRA, Grun JT,
Papi F, Bazzicalupi C, Messori L, Gratteri P, Schwalbe
H |
(2017) "Solution
NMR Structure of a Ligand/Hybrid-2-G-Quadruplex Complex
Reveals Rearrangements that Affect Ligand Binding."
Angew. Chem. Int. Ed. Engl.,
56, 7102-7106. doi: 10.1002/anie.201702135.
|
Solution structure of a human g-quadruplex hybrid-2
form in complex with a gold-ligand. . ➥ 3
G-tetrads, 1 G4 helix, 1 G4 stem, UDUU, hybrid3, 3+1,
3(-Lw-Ln-P)
|
|
5nys
|
DNA |
NMR |
Trajkovski M, Endoh T, Tateishi-Karimata H, Ohyama T,
Tanaka S, Plavec J, Sugimoto N |
(2018) "Pursuing
origins of (poly)ethylene glycol-induced G-quadruplex
structural modulations." Nucleic Acids
Res., 46, 4301-4315. doi:
10.1093/nar/gky250.
|
M2 g-quadruplex dilute solution . ➥ 3
G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0,
3(-P-P-P)
|
|
5nyt
|
DNA |
NMR |
Trajkovski M, Endoh T, Tateishi-Karimata H, Ohyama T,
Tanaka S, Plavec J, Sugimoto N |
(2018) "Pursuing
origins of (poly)ethylene glycol-induced G-quadruplex
structural modulations." Nucleic Acids
Res., 46, 4301-4315. doi:
10.1093/nar/gky250.
|
M2 g-quadruplex 20 wt% ethylene glycol . ➥ 3
G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0,
3(-P-P-P)
|
|
5nyu
|
DNA |
NMR |
Trajkovski M, Endoh T, Tateishi-Karimata H, Ohyama T,
Tanaka S, Plavec J, Sugimoto N |
(2018) "Pursuing
origins of (poly)ethylene glycol-induced G-quadruplex
structural modulations." Nucleic Acids
Res., 46, 4301-4315. doi:
10.1093/nar/gky250.
|
M2 g-quadruplex 10 wt% peg8000 . ➥ 3
G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0,
3(-P-P-P)
|
|
5o4d
|
DNA |
NMR |
Marusic M, Plavec J |
(2019) "Towards
Understanding of Polymorphism of the G-rich Region of
Human Papillomavirus Type 52." Molecules,
24. doi: 10.3390/molecules24071294.
|
G-quadruplex of human papillomavirus type 52 .
➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UDDD, hybrid4, 1+3, 2(-LwX+P)
|
|
5ob3
|
RNA |
X-ray (2.004 Å) |
Fernandez-Millan P, Autour A, Ennifar E, Westhof E,
Ryckelynck M |
(2017) "Crystal
structure and fluorescence properties of the iSpinach
aptamer in complex with DFHBI." RNA,
23, 1788-1795. doi: 10.1261/rna.063008.117.
|
Ispinach aptamer . ➥ 2 G-tetrads, 1 G4 helix, 1 G4
stem, UUDD, anti-parallel:basket2, 2+2, 2(-PD+P)
|
|
5oph
|
DNA |
NMR |
Brcic J, Plavec J |
(2018) "NMR
structure of a G-quadruplex formed by four d(G4C2)
repeats: insights into structural polymorphism."
Nucleic Acids Res., 46,
11605-11617. doi: 10.1093/nar/gky886.
|
G-quadruplex structure of DNA oligonucleotide
containing ggggcc repeats linked to als and ftd .
➥ 4 G-tetrads, 1 G4 helix, 1 G4
stem, UDUD, anti-parallel:chair, 2+2, 4(-Lw-Ln-Lw)
|
|
5ov2
|
DNA |
NMR |
Dickerhoff J, Weisz K |
(2017) "Nonconventional
C-HF Hydrogen Bonds Support a Tetrad Flip in Modified
G-Quadruplexes." J Phys Chem Lett,
8, 5148-5152. doi: 10.1021/acs.jpclett.7b02428.
|
2'f-ana-g modified quadruplex with a flipped tetrad .
➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUD, hybrid2, 3+1, 3(-PD+Lw)
|
|
5ua3
|
DNA |
X-ray (1.88 Å) |
Meier M, Moya-Torres A, Krahn NJ, McDougall MD,
Orriss GL, McRae EKS, Booy EP, McEleney K, Patel TR,
McKenna SA, Stetefeld J |
(2018) "Structure
and hydrodynamics of a DNA G-quadruplex with a cytosine
bulge." Nucleic Acids Res.,
46, 5319-5331. doi: 10.1093/nar/gky307.
|
Crystal structure of a DNA g-quadruplex with a cytosine
bulge . ➥ 6 G-tetrads, 1 G4 helix, 2 G4
stems, 1 G4 coaxial stack, UUUU, parallel, 4+0,
3(-P-P-P), coaxial interfaces: 5'/5'
|
|
5v3f
|
RNA |
X-ray (1.7 Å) |
Trachman RJ, Demeshkina NA, Lau MWL, Panchapakesan
SSS, Jeng SCY, Unrau PJ, Ferre-D'Amare AR |
(2017) "Structural
basis for high-affinity fluorophore binding and
activation by RNA Mango." Nat. Chem.
Biol., 13, 807-813. doi: 10.1038/nchembio.2392.
|
Co-crystal structure of the fluorogenic RNA mango .
➥ 6 G-tetrads, 1 G4 helix, 2 G4
stems, 1 G4 coaxial stack, UUUU, parallel, 4+0,
3(-P-P-P), coaxial interfaces: 5'/5'
|
|
5vhe
|
hydrolase |
X-ray (3.793 Å) |
Chen MC, Tippana R, Demeshkina NA, Murat P,
Balasubramanian S, Myong S, Ferre-D'Amare AR |
(2018) "Structural
basis of G-quadruplex unfolding by the DEAH/RHA
helicase DHX36." Nature,
558, 465-469. doi: 10.1038/s41586-018-0209-9.
|
Dhx36 in complex with the c-myc g-quadruplex .
➥ 2 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 2(-P-P-P)
|
|
5w77
|
DNA-inhibitor |
NMR |
Calabrese DR, Chen X, Leon EC, Gaikwad SM, Phyo Z,
Hewitt WM, Alden S, Hilimire TA, He F, Michalowski AM,
Simmons JK, Saunders LB, Zhang S, Connors D, Walters KJ,
Mock BA, Schneekloth Jr JS |
(2018) "Chemical
and structural studies provide a mechanistic basis for
recognition of the MYC G-quadruplex." Nat
Commun, 9, 4229. doi: 10.1038/s41467-018-06315-w.
|
Solution structure of the myc g-quadruplex bound to
small molecule dc-34 . ➥
3 G-tetrads, 1 G4 helix,
1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
5yey
|
DNA |
NMR |
Liu C, Zhou B, Geng Y, Yan Tam D, Feng R, Miao H, Xu
N, Shi X, You Y, Hong Y, Tang BZ, Kwan Lo P, Kuryavyi V,
Zhu G |
(2019) "A
chair-type G-quadruplex structure formed by a human
telomeric variant DNA in K+solution." Chem
Sci, 10, 218-226. doi: 10.1039/c8sc03813a.
|
The structure of a chair-type g-quadruplex of the human
telomeric variant in k+ solution . ➥ 3
G-tetrads, 1 G4 helix, 1 G4 stem, UDUD,
anti-parallel:chair, 2+2, 3(+Ln+Lw+Ln)
|
|
5z80
|
DNA |
NMR |
Liu W, Zhong YF, Liu LY, Shen CT, Zeng W, Wang F,
Yang D, Mao ZW |
(2018) "Solution
structures of multiple G-quadruplex complexes induced
by a platinum(II)-based tripod reveal dynamic
binding." Nat Commun, 9,
3496. doi: 10.1038/s41467-018-05810-4.
|
Solution structure for the 1:1 complex of a
platinum(ii)-based tripod bound to a hybrid-1 human
telomeric g-quadruplex . ➥
3 G-tetrads, 1 G4 helix,
1 G4 stem, UUDU, hybrid1, 3+1, 3(-P-Lw-Ln)
|
|
5z8f
|
DNA |
NMR |
Liu W, Zhong YF, Liu LY, Shen CT, Zeng W, Wang F,
Yang D, Mao ZW |
(2018) "Solution
structures of multiple G-quadruplex complexes induced
by a platinum(II)-based tripod reveal dynamic
binding." Nat Commun, 9,
3496. doi: 10.1038/s41467-018-05810-4.
|
Solution structure for the unique dimeric 4:2 complex
of a platinum(ii)-based tripod bound to a hybrid-1
human telomeric g-quadruplex . ➥ 6
G-tetrads, 2 G4 helices, 2 G4 stems, UUDU, hybrid1,
3+1, 3(-P-Lw-Ln)
|
|
5zev
|
DNA |
NMR |
Liu Y, Lan W, Wang C, Cao C |
(2018) "A
putative G-quadruplex structure in the proximal
promoter ofVEGFR-2has implications for drug design to
inhibit tumor angiogenesis." J. Biol.
Chem., 293, 8947-8955. doi:
10.1074/jbc.RA118.002666.
|
Solution structure of g-quadruplex formed in vegfr-2
proximal promoter sequence . ➥
3 G-tetrads, 1 G4 helix,
1 G4 stem, UDDD, hybrid4, 1+3, 2(D+PX)
|
|
6a7y
|
DNA |
NMR |
Wan C, Fu W, Jing H, Zhang N |
(2019) "NMR
solution structure of an asymmetric intermolecular
leaped V-shape G-quadruplex: selective recognition of
the d(G2NG3NG4) sequence motif by a short linear G-rich
DNA probe." Nucleic Acids Res.,
47, 1544-1556. doi: 10.1093/nar/gky1167.
|
Solution structure of an intermolecular leaped v-shape
g-quadruplex . ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UDDD, hybrid4, 1+3
|
|
6a85
|
DNA |
X-ray (1.45 Å) |
Liu HH, Wang R, Yu X, Shen FS, Lan WX,
Haruehanroengra P, Yao QQ, Zhang J, Chen YQ, Li SH, Wu
BX, Zheng LN, Ma JB, Lin JZ, Cao CY, Li JX, Sheng J, Gan
JH |
(2018) "High-resolution
DNA quadruplex structure containing all the A-, G-, C-,
T-tetrads." Nucleic Acids Res.,
46, 11627-11638. doi: 10.1093/nar/gky902.
|
Crystal structure of a novel DNA quadruplex .
➥ 8 G-tetrads, 2 G4 helices, 2 G4
stems, UUUU, parallel, 4+0
|
|
6ac7
|
DNA |
NMR |
Sengar A, Vandana JJ, Chambers VS, Di Antonio M,
Winnerdy FR, Balasubramanian S, Phan AT |
(2019) "Structure
of a (3+1) hybrid G-quadruplex in the PARP1
promoter." Nucleic Acids Res.,
47, 1564-1572. doi: 10.1093/nar/gky1179.
|
Structure of a (3+1) hybrid g-quadruplex in the parp1
promoter . ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UDUU, hybrid3, 3+1, 3(-Lw-Ln-P)
|
|
6au4
|
DNA |
X-ray (2.35 Å) |
Stump S, Mou TC, Sprang SR, Natale NR, Beall HD |
(2018) "Crystal
structure of the major quadruplex formed in the
promoter region of the human c-MYC oncogene."
PLoS ONE, 13, e0205584. doi:
10.1371/journal.pone.0205584.
|
Crystal structure of the major quadruplex formed in the
human c-myc promoter . ➥
6 G-tetrads, 2 G4
helices, 2 G4 stems, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
6b14
|
immune system-RNA |
X-ray (1.64 Å) |
Koirala D, Shelke SA, Dupont M, Ruiz S, DasGupta S,
Bailey LJ, Benner SA, Piccirilli JA |
(2018) "Affinity
maturation of a portable Fab-RNA module for
chaperone-assisted RNA crystallography."
Nucleic Acids Res., 46,
2624-2635. doi: 10.1093/nar/gkx1292.
|
Crystal structure of spinach RNA aptamer in complex
with fab bl3-6s97n . ➥
2 G-tetrads, 1 G4 helix,
1 G4 stem, UUDD, anti-parallel:basket2, 2+2,
2(-PD+P)
|
|
6b3k
|
immune system-RNA |
X-ray (2.09 Å) |
Koirala D, Shelke SA, Dupont M, Ruiz S, DasGupta S,
Bailey LJ, Benner SA, Piccirilli JA |
(2018) "Affinity
maturation of a portable Fab-RNA module for
chaperone-assisted RNA crystallography."
Nucleic Acids Res., 46,
2624-2635. doi: 10.1093/nar/gkx1292.
|
Crystal structure of mutant spinach RNA aptamer in
complex with fab bl3-6 . ➥
2 G-tetrads, 1 G4 helix,
1 G4 stem, UUDD, anti-parallel:basket2, 2+2,
2(-PD+P)
|
|
6c63
|
RNA |
X-ray (2.9 Å) |
Trachman 3rd RJ, Abdolahzadeh A, Andreoni A, Cojocaru
R, Knutson JR, Ryckelynck M, Unrau PJ, Ferre-D'Amare
AR |
(2018) "Crystal
Structures of the Mango-II RNA Aptamer Reveal
Heterogeneous Fluorophore Binding and Guide Engineering
of Variants with Improved Selectivity and
Brightness." Biochemistry,
57, 3544-3548. doi: 10.1021/acs.biochem.8b00399.
|
Crystal structure of the mango-ii fluorescent aptamer
bound to to1-biotin . ➥
3 G-tetrads, 1 G4 helix,
1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
6c64
|
RNA |
X-ray (3.0 Å) |
Trachman 3rd RJ, Abdolahzadeh A, Andreoni A, Cojocaru
R, Knutson JR, Ryckelynck M, Unrau PJ, Ferre-D'Amare
AR |
(2018) "Crystal
Structures of the Mango-II RNA Aptamer Reveal
Heterogeneous Fluorophore Binding and Guide Engineering
of Variants with Improved Selectivity and
Brightness." Biochemistry,
57, 3544-3548. doi: 10.1021/acs.biochem.8b00399.
|
Crystal structure of the mango-ii fluorescent aptamer
bound to to3-biotin . ➥
3 G-tetrads, 1 G4 helix,
1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
6c65
|
RNA |
X-ray (2.8 Å) |
Trachman 3rd RJ, Abdolahzadeh A, Andreoni A, Cojocaru
R, Knutson JR, Ryckelynck M, Unrau PJ, Ferre-D'Amare
AR |
(2018) "Crystal
Structures of the Mango-II RNA Aptamer Reveal
Heterogeneous Fluorophore Binding and Guide Engineering
of Variants with Improved Selectivity and
Brightness." Biochemistry,
57, 3544-3548. doi: 10.1021/acs.biochem.8b00399.
|
Crystal structure of the mango-ii-a22u fluorescent
aptamer bound to to1-biotin . ➥ 3
G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0,
3(-P-P-P)
|
|
6ccw
|
DNA |
NMR |
Lin C, Wu G, Wang K, Onel B, Sakai S, Shao Y, Yang
D |
(2018) "Molecular
Recognition of the Hybrid-2 Human Telomeric
G-Quadruplex by Epiberberine: Insights into Conversion
of Telomeric G-Quadruplex Structures." Angew.
Chem. Int. Ed. Engl., 57,
10888-10893. doi: 10.1002/anie.201804667.
|
Hybrid-2 form human telomeric g quadruplex in complex
with epiberberine . ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UDUU, hybrid3, 3+1, 3(-Lw-Ln-P)
|
|
6e80
|
RNA |
X-ray (2.901 Å) |
Sjekloca L, Ferre-D'Amare AR |
(2019) "Binding
between G Quadruplexes at the Homodimer Interface of
the Corn RNA Aptamer Strongly Activates Thioflavin T
Fluorescence." Cell Chem Biol,
26, 1159. doi: 10.1016/j.chembiol.2019.04.012.
|
Crystal structure of the corn aptamer in unliganded
state . ➥ 4 G-tetrads, 1 G4 helix, 2 G4
stems, 1 G4 coaxial stack, UUUU, parallel, 4+0,
2(-P-P-P), coaxial interfaces: 5'/5'
|
|
6e81
|
RNA |
X-ray (2.721 Å) |
Sjekloca L, Ferre-D'Amare AR |
(2019) "Binding
between G Quadruplexes at the Homodimer Interface of
the Corn RNA Aptamer Strongly Activates Thioflavin T
Fluorescence." Cell Chem Biol,
26, 1159. doi: 10.1016/j.chembiol.2019.04.012.
|
Crystal structure of the corn aptamer in complex with
tht . ➥ 4 G-tetrads, 2 G4 helices, 2 G4
stems, UUUU, parallel, 4+0, 2(-P-P-P)
|
|
6e82
|
RNA |
X-ray (3.101 Å) |
Sjekloca L, Ferre-D'Amare AR |
(2019) "Binding
between G Quadruplexes at the Homodimer Interface of
the Corn RNA Aptamer Strongly Activates Thioflavin T
Fluorescence." Cell Chem Biol,
26, 1159. doi: 10.1016/j.chembiol.2019.04.012.
|
Crystal structure of the corn aptamer mutant a14u in
complex with tht . ➥ 2 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 2(-P-P-P)
|
|
6e84
|
RNA |
X-ray (2.901 Å) |
Sjekloca L, Ferre-D'Amare AR |
(2019) "Binding
between G Quadruplexes at the Homodimer Interface of
the Corn RNA Aptamer Strongly Activates Thioflavin T
Fluorescence." Cell Chem Biol,
26, 1159. doi: 10.1016/j.chembiol.2019.04.012.
|
Crystal structure of the corn aptamer in complex with
to . ➥ 4 G-tetrads, 2 G4 helices, 2 G4
stems, UUUU, parallel, 4+0, 2(-P-P-P)
|
|
6e8s
|
RNA |
X-ray (2.35 Å) |
Trachman 3rd RJ, Autour A, Jeng SCY, Abdolahzadeh A,
Andreoni A, Cojocaru R, Garipov R, Dolgosheina EV,
Knutson JR, Ryckelynck M, Unrau PJ, Ferre-D'Amare AR |
(2019) "Structure
and functional reselection of the Mango-III fluorogenic
RNA aptamer." Nat. Chem. Biol.,
15, 472-479. doi: 10.1038/s41589-019-0267-9.
|
Structure of the imango-iii aptamer bound to to1-biotin
. ➥ 2 G-tetrads, 1 G4 helix, 1 G4
stem, UUUD, hybrid2, 3+1, 2(-P-P-Lw)
|
|
6e8t
|
RNA |
X-ray (2.9 Å) |
Trachman 3rd RJ, Autour A, Jeng SCY, Abdolahzadeh A,
Andreoni A, Cojocaru R, Garipov R, Dolgosheina EV,
Knutson JR, Ryckelynck M, Unrau PJ, Ferre-D'Amare AR |
(2019) "Structure
and functional reselection of the Mango-III fluorogenic
RNA aptamer." Nat. Chem. Biol.,
15, 472-479. doi: 10.1038/s41589-019-0267-9.
|
Structure of the mango-iii (a10u) aptamer bound to
to1-biotin . ➥ 2 G-tetrads, 1 G4 helix, 1 G4
stem, UUUD, hybrid2, 3+1, 2(-P-Lw)
|
|
6e8u
|
RNA |
X-ray (1.55 Å) |
Trachman 3rd RJ, Autour A, Jeng SCY, Abdolahzadeh A,
Andreoni A, Cojocaru R, Garipov R, Dolgosheina EV,
Knutson JR, Ryckelynck M, Unrau PJ, Ferre-D'Amare AR |
(2019) "Structure
and functional reselection of the Mango-III fluorogenic
RNA aptamer." Nat. Chem. Biol.,
15, 472-479. doi: 10.1038/s41589-019-0267-9.
|
Structure of the mango-iii (a10u) aptamer bound to
to1-biotin . ➥ 2 G-tetrads, 1 G4 helix, 1 G4
stem, UUUD, hybrid2, 3+1, 2(-P-P-Lw)
|
|
6eo6
|
hydrolase-DNA |
X-ray (1.69 Å) |
Dolot R, Lam CH, Sierant M, Zhao Q, Liu FW, Nawrot B,
Egli M, Yang X |
(2018) "Crystal
structures of thrombin in complex with chemically
modified thrombin DNA aptamers reveal the origins of
enhanced affinity." Nucleic Acids Res.,
46, 4819-4830. doi: 10.1093/nar/gky268.
|
X-ray structure of the complex between human
alpha-thrombin and modified 15-mer DNA aptamer
containing
5-(3-(2-(1h-indol-3-yl)acetamide-n-yl)-1-propen-1-yl)-2'-deoxyuridine
residue . ➥ 2 G-tetrads, 1 G4 helix, 1 G4
stem, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
|
|
6eo7
|
hydrolase-DNA |
X-ray (2.24 Å) |
Dolot R, Lam CH, Sierant M, Zhao Q, Liu FW, Nawrot B,
Egli M, Yang X |
(2018) "Crystal
structures of thrombin in complex with chemically
modified thrombin DNA aptamers reveal the origins of
enhanced affinity." Nucleic Acids Res.,
46, 4819-4830. doi: 10.1093/nar/gky268.
|
X-ray structure of the complex between human
alpha-thrombin and modified 15-mer DNA aptamer
containing
5-(3-(acetamide-n-yl)-1-propen-1-yl)-2'-deoxyuridine
residue . ➥ 2 G-tetrads, 1 G4 helix, 1 G4
stem, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
|
|
6erl
|
DNA |
NMR |
Karg B, Weisz K |
(2018) "Loop
Length Affects Syn-Anti Conformational Rearrangements
in Parallel G-Quadruplexes." Chemistry.
doi: 10.1002/chem.201801851.
|
Quadruplex with flipped tetrad formed by the c-myc
promoter sequence . ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
6evv
|
hydrolase |
X-ray (2.5 Å) |
Troisi R, Napolitano V, Spiridonova V, Russo Krauss
I, Sica F |
(2018) "Several
structural motifs cooperate in determining the highly
effective anti-thrombin activity of NU172 aptamer."
Nucleic Acids Res., 46,
12177-12185. doi: 10.1093/nar/gky990.
|
X-ray structure of the complex between human alpha
thrombin and nu172, a duplex-quadruplex 26-mer DNA
aptamer, in the presence of potassium ions. .
➥ 2 G-tetrads, 1 G4 helix, 1 G4
stem, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
|
|
6f4z
|
DNA |
NMR |
Dickerhoff J, Weisz K |
(2018) "Fluorine-Mediated
Editing of a G-Quadruplex Folding Pathway."
Chembiochem, 19, 927-930.
doi: 10.1002/cbic.201800099.
|
2'f-arag modified quadruplex with flipped g-tract and
central tetrad . ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUDD, anti-parallel:basket2, 2+2, 3(+LnD-Lw)
|
|
6fc9
|
DNA |
NMR |
Diaz-Casado L, Serrano-Chacon I, Montalvillo-Jimenez
L, Corzana F, Bastida A, Santana AG, Gonzalez C, Asensio
JL |
(2020) "De Novo
Design of Selective Quadruplex-Duplex Junction Ligands
and Structural Characterisation of Their Binding Mode:
Targeting the G4 Hot-Spot." Chemistry.
doi: 10.1002/chem.202005026.
|
The 1,8-bis(aminomethyl)anthracene and
quadruplex-duplex junction complex . ➥ 2
G-tetrads, 1 G4 helix, 1 G4 stem, UDUD,
anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
|
|
6ffr
|
DNA-RNA hybrid |
NMR |
Haase L, Dickerhoff J, Weisz K |
(2018) "DNA-RNA
Hybrid Quadruplexes Reveal Interactions that Favor RNA
Parallel Topologies." Chemistry,
24, 15365-15371. doi: 10.1002/chem.201803367.
|
DNA-RNA hybrid quadruplex with flipped tetrad .
➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUD, hybrid2, 3+1, 3(-PD+Lw)
|
|
6fq2
|
DNA |
X-ray (2.31 Å) |
Bakalar B, Heddi B, Schmitt E, Mechulam Y, Phan
AT |
(2019) "A
Minimal Sequence for Left-Handed G-Quadruplex
Formation." Angew. Chem. Int. Ed. Engl.,
58, 2331-2335. doi: 10.1002/anie.201812628.
|
Structure of minimal sequence for left -handed
g-quadruplex formation . ➥
4 G-tetrads, 1 G4
helix
|
|
6ftu
|
DNA |
X-ray (2.95 Å) |
Guedin A, Lin LY, Armane S, Lacroix L, Mergny JL,
Thore S, Yatsunyk LA |
(2018) "Quadruplexes
in 'Dicty': crystal structure of a four-quartet
G-quadruplex formed by G-rich motif found in the
Dictyostelium discoideum genome." Nucleic Acids
Res., 46, 5297-5307. doi:
10.1093/nar/gky290.
|
Structure of a quadruplex forming sequence from d.
discoideum . ➥ 4 G-tetrads, 1 G4 helix, 1 G4
stem, UUDD, anti-parallel:basket2, 2+2, 4(+LnD-Lw)
|
|
6ge1
|
RNA |
NMR |
Andralojc W, Malgowska M, Sarzynska J, Pasternak K,
Szpotkowski K, Kierzek R, Gdaniec Z |
(2019) "Unraveling
the structural basis for the exceptional stability of
RNA G-quadruplexes capped by a uridine tetrad at the 3'
terminus." RNA, 25,
121-134. doi: 10.1261/rna.068163.118.
|
Solution structure of the r(ugguggu)4 RNA quadruplex .
➥ 4 G-tetrads, 1 G4 helix, 2 G4
stems, 1 G4 coaxial stack, UUUU, parallel, 4+0, coaxial
interfaces: 3'/5'
|
|
6gh0
|
DNA |
NMR |
Kotar A, Rigo R, Sissi C, Plavec J |
(2019) "Two-quartet
kit* G-quadruplex is formed via double-stranded
pre-folded structure." Nucleic Acids Res.,
47, 2641-2653. doi: 10.1093/nar/gky1269.
|
Two-quartet kit* g-quadruplex is formed via
double-stranded pre-folded structure . ➥ 2
G-tetrads, 1 G4 helix, 1 G4 stem, UDUD,
anti-parallel:chair, 2+2, 2(-Lw-Ln-Lw)
|
|
6gn7
|
hydrolase |
X-ray (2.8 Å) |
Troisi R, Napolitano V, Spiridonova V, Russo Krauss
I, Sica F |
(2018) "Several
structural motifs cooperate in determining the highly
effective anti-thrombin activity of NU172 aptamer."
Nucleic Acids Res., 46,
12177-12185. doi: 10.1093/nar/gky990.
|
X-ray structure of the complex between human alpha
thrombin and nu172, a duplex-quadruplex 26-mer DNA
aptamer, in the presence of sodium ions. . ➥ 2
G-tetrads, 1 G4 helix, 1 G4 stem, UDUD,
anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
|
|
6gz6
|
DNA |
X-ray (2.006 Å) |
Bakalar B, Heddi B, Schmitt E, Mechulam Y, Phan
AT |
(2019) "A
Minimal Sequence for Left-Handed G-Quadruplex
Formation." Angew.Chem.Int.Ed.Engl.,
58, 2331-2335. doi: 10.1002/anie.201812628.
|
Structure of a left-handed g-quadruplex . ➥ 4
G-tetrads, 1 G4 helix
|
|
6gzn
|
DNA |
NMR |
Lenarcic Zivkovic M, Rozman J, Plavec J |
(2018) "Adenine-Driven
Structural Switch from a Two- to Three-Quartet DNA
G-Quadruplex." Angew. Chem. Int. Ed.
Engl., 57, 15395-15399. doi:
10.1002/anie.201809328.
|
Adenine-driven structural switch from two- to
three-quartet DNA g-quadruplex . ➥ 2
G-tetrads, 1 G4 helix, 1 G4 stem, UDDU,
anti-parallel:basket, 2+2, 2(-LwD+Ln)
|
|
6h1k
|
DNA |
NMR |
Butovskaya E, Heddi B, Bakalar B, Richter SN, Phan
AT |
(2018) "Major
G-Quadruplex Form of HIV-1 LTR Reveals a (3 + 1)
Folding Topology Containing a Stem-Loop." J.
Am. Chem. Soc., 140, 13654-13662.
doi: 10.1021/jacs.8b05332.
|
The major g-quadruplex form of hiv-1 ltr . ➥ 3
G-tetrads, 1 G4 helix, 1 G4 stem, UDDD, hybrid4, 1+3,
2(D+PX)
|
|
6h5r
|
DNA |
X-ray (2.0 Å) |
Guarra F, Marzo T, Ferraroni M, Papi F, Bazzicalupi
C, Gratteri P, Pescitelli G, Messori L, Biver T, Gabbiani
C |
(2018) "Interaction
of a gold(i) dicarbene anticancer drug with human
telomeric DNA G-quadruplex: solution and
computationally aided X-ray diffraction analysis."
Dalton Trans, 47,
16132-16138. doi: 10.1039/c8dt03607a.
|
Structure of the complex of a human telomeric DNA with
bis(1-butyl-3-methyl-imidazole-2-ylidene) gold(i) .
➥ 6 G-tetrads, 1 G4 helix, 2 G4
stems, 1 G4 coaxial stack, UUUU, parallel, 4+0,
3(-P-P-P), coaxial interfaces: 5'/5'
|
|
6ia0
|
DNA |
NMR |
Bielskute S, Plavec J, Podbevsek P |
(2019) "Impact
of Oxidative Lesions on the Human Telomeric
G-Quadruplex." J. Am. Chem. Soc.,
141, 2594-2603. doi: 10.1021/jacs.8b12748.
|
Human telomeric g-quadruplex with 8-oxo-g substitution
in the central g-quartet . ➥
3 G-tetrads, 1 G4 helix,
1 G4 stem, UDUU, hybrid3, 3+1, 3(-Lw-Ln-P)
|
|
6ia4
|
DNA |
NMR |
Bielskute S, Plavec J, Podbevsek P |
(2019) "Impact
of Oxidative Lesions on the Human Telomeric
G-Quadruplex." J. Am. Chem. Soc.,
141, 2594-2603. doi: 10.1021/jacs.8b12748.
|
Human telomeric g-quadruplex with 8-oxo-g substitution
in the outer g-quartet . ➥
3 G-tetrads, 1 G4 helix,
1 G4 stem, UUDU, hybrid1, 3+1, 3(-P-Lw-Ln)
|
|
6ip3
|
DNA |
X-ray (1.4 Å) |
Nuthanakanti A, Ahmed I, Khatik SY, Saikrishnan K,
Srivatsan SG |
(2019) "Probing
G-quadruplex topologies and recognition concurrently in
real time and 3D using a dual-app nucleoside
probe." Nucleic Acids Res.,
47, 6059-6072. doi: 10.1093/nar/gkz419.
|
Structure of human telomeric DNA at 1.4 angstroms
resolution . ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
6ip7
|
DNA |
X-ray (1.55 Å) |
Nuthanakanti A, Ahmed I, Khatik SY, Saikrishnan K,
Srivatsan SG |
(2019) "Probing
G-quadruplex topologies and recognition concurrently in
real time and 3D using a dual-app nucleoside
probe." Nucleic Acids Res.,
47, 6059-6072. doi: 10.1093/nar/gkz419.
|
Structure of human telomeric DNA with
5-selenophene-modified deoxyuridine at residue 11 .
➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 3(-P-P)
|
|
6isw
|
DNA |
X-ray (2.3 Å) |
Nuthanakanti A, Ahmed I, Khatik SY, Saikrishnan K,
Srivatsan SG |
(2019) "Probing
G-quadruplex topologies and recognition concurrently in
real time and 3D using a dual-app nucleoside
probe." Nucleic Acids Res.,
47, 6059-6072. doi: 10.1093/nar/gkz419.
|
Structure of human telomeric DNA with
5-selenophene-modified deoxyuridine at residue 12 .
➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 3(-P-P)
|
|
6jcd
|
DNA |
NMR |
Truong THA, Winnerdy FR, Phan AT |
(2019) "An
Unprecedented Knot-like G-Quadruplex Peripheral
Motif." Angew.Chem.Int.Ed.Engl.,
58, 13834-13839. doi: 10.1002/anie.201907740.
|
G-quadruplex peripheral knot . ➥ 2
G-tetrads, 1 G4 helix
|
|
6jce
|
DNA |
NMR |
Winnerdy FR, Bakalar B, Maity A, Vandana JJ, Mechulam
Y, Schmitt E, Phan AT |
(2019) "NMR
solution and X-ray crystal structures of a DNA molecule
containing both right- and left-handed
parallel-stranded G-quadruplexes." Nucleic
Acids Res., 47, 8272-8281. doi:
10.1093/nar/gkz349.
|
NMR solution and x-ray crystal structures of a DNA
containing both right-and left-handed parallel-stranded
g-quadruplexes . ➥ 4 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 2(-P-P-P)
|
|
6jj0
|
DNA |
NMR |
Liu W, Lin C, Wu G, Dai J, Chang TC, Yang D |
(2019) "Structures
of 1:1 and 2:1 complexes of BMVC and MYC promoter
G-quadruplex reveal a mechanism of ligand conformation
adjustment for G4-recognition." Nucleic Acids
Res., 47, 11931-11942. doi:
10.1093/nar/gkz1015.
|
NMR structure of the 1:1 complex of a carbazole
derivative bmvc bound to c-myc g-quadruplex .
➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
6jje
|
DNA |
X-ray (1.378 Å) |
Zhang YS, Parkinson GN, Wagner A, Wei DG |
"Crystal structure of a two-quartet DNA
mixed-parallel/antiparallel G-quadruplex (BrU)." |
Crystal structure of a two-quartet DNA
mixed-parallel-antiparallel g-quadruplex (bru) .
➥ 4 G-tetrads, 1 G4 helix, 2 G4
stems, 1 G4 coaxial stack, UDUD, anti-parallel:chair,
2+2; UUUU, parallel, 4+0, coaxial interfaces: mixed
|
|
6jjf
|
DNA |
X-ray (1.47 Å) |
Zhang Y, El Omari K, Duman R, Liu S, Haider S, Wagner
A, Parkinson GN, Wei D |
(2020) "Native
de novo structural determinations of non-canonical
nucleic acid motifs by X-ray crystallography at long
wavelengths." Nucleic Acids Res.,
48, 9886-9898. doi: 10.1093/nar/gkaa439.
|
Crystal structure of a two-quartet DNA
mixed-parallel-antiparallel g-quadruplex . ➥ 4
G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack,
UDUD, anti-parallel:chair, 2+2; UUUU, parallel, 4+0,
coaxial interfaces: mixed
|
|
6jjg
|
DNA |
X-ray (1.969 Å) |
Zhang YS, Parkinson GN, Wagner A, Wei DG |
"Crystal structure of a two-quartet DNA
mixed-parallel/antiparallel G-quadruplex." |
Crystal structure of a two-quartet DNA
mixed-parallel-antiparallel g-quadruplex . ➥ 4
G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack,
UDUD, anti-parallel:chair, 2+2; UUUU, parallel, 4+0,
coaxial interfaces: mixed
|
|
6jjh
|
RNA |
X-ray (1.74 Å) |
Zhang Y, El Omari K, Duman R, Liu S, Haider S, Wagner
A, Parkinson GN, Wei D |
(2020) "Native
de novo structural determinations of non-canonical
nucleic acid motifs by X-ray crystallography at long
wavelengths." Nucleic Acids Res.,
48, 9886-9898. doi: 10.1093/nar/gkaa439.
|
Crystal structure of a two-quartet RNA parallel
g-quadruplex complexed with the porphyrin tmpyp4 .
➥ 4 G-tetrads, 1 G4 helix, 2 G4
stems, 1 G4 coaxial stack, UUUU, parallel, 4+0, coaxial
interfaces: 3'/5'
|
|
6jji
|
RNA |
X-ray (3.1 Å) |
Zhang Y, El Omari K, Duman R, Liu S, Haider S, Wagner
A, Parkinson GN, Wei D |
(2020) "Native
de novo structural determinations of non-canonical
nucleic acid motifs by X-ray crystallography at long
wavelengths." Nucleic Acids Res.,
48, 9886-9898. doi: 10.1093/nar/gkaa439.
|
Crystal structure of a two-quartet RNA parallel
g-quadruplex complexed with the porphyrin tmpyp4 (1:1)
. ➥ 4 G-tetrads, 1 G4 helix, 2 G4
stems, 1 G4 coaxial stack, UUUU, parallel, 4+0, coaxial
interfaces: 3'/5'
|
|
6jkn
|
DNA |
X-ray (1.401 Å) |
Geng Y, Liu C, Zhou B, Cai Q, Miao H, Shi X, Xu N,
You Y, Fung CP, Din RU, Zhu G |
(2019) "The
crystal structure of an antiparallel chair-type
G-quadruplex formed by Bromo-substituted human
telomeric DNA." Nucleic Acids Res.,
47, 5395-5404. doi: 10.1093/nar/gkz221.
|
Crystal structure of g-quadruplex formed by
bromo-substituted human telomeric DNA . ➥ 3
G-tetrads, 1 G4 helix, 1 G4 stem, UDUD,
anti-parallel:chair, 2+2, 3(-Lw-Ln-Lw)
|
|
6jwd
|
DNA |
NMR |
Wang F, Wang C, Liu Y, Lan W, Han H, Wang R, Huang S,
Cao C |
(2020) "Colchicine
selective interaction with oncogene RET G-quadruplex
revealed by NMR." Chem.Commun.(Camb.),
56, 2099-2102. doi: 10.1039/d0cc00221f.
|
Structure of ret g-quadruplex in complex with berberine
. ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
6jwe
|
DNA |
NMR |
Wang F, Wang C, Liu Y, Lan W, Han H, Wang R, Huang S,
Cao C |
(2020) "Colchicine
selective interaction with oncogene RET G-quadruplex
revealed by NMR." Chem.Commun.(Camb.),
56, 2099-2102. doi: 10.1039/d0cc00221f.
|
Structure of ret g-quadruplex in complex with
colchicine . ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
6k3x
|
DNA |
NMR |
Winnerdy FR, Das P, Heddi B, Phan AT |
(2019) "Solution
Structures of a G-Quadruplex Bound to Linear- and
Cyclic-Dinucleotides." J.Am.Chem.Soc.,
141, 18038-18047. doi: 10.1021/jacs.9b05642.
|
G-quadruplex complex with linear dinucleotide d(ag) .
➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 2(-P-P-P)
|
|
6k3y
|
DNA |
NMR |
Winnerdy FR, Das P, Heddi B, Phan AT |
(2019) "Solution
Structures of a G-Quadruplex Bound to Linear- and
Cyclic-Dinucleotides." J.Am.Chem.Soc.,
141, 18038-18047. doi: 10.1021/jacs.9b05642.
|
G-quadruplex complex with cyclic dinucleotide 3'-3'
cgamp . ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 2(-P-P-P)
|
|
6k84
|
RNA |
NMR |
Mashima T, Lee JH, Kamatari YO, Hayashi T, Nagata T,
Nishikawa F, Nishikawa S, Kinoshita M, Kuwata K, Katahira
M |
(2020) "Development
and structural determination of an anti-PrPCaptamer
that blocks pathological conformational conversion of
prion protein." Sci Rep,
10, 4934. doi: 10.1038/s41598-020-61966-4.
|
Structure of anti-prion RNA aptamer . ➥ 4
G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack,
UUUU, parallel, 4+0, 2(-P-P-P), coaxial interfaces:
5'/5'
|
|
6kfi
|
DNA |
NMR |
Liu LY, Liu W, Wang KN, Zhu BC, Xia XY, Ji LN, Mao
ZW |
(2020) "Quantitative
Detection of G-Quadruplex DNA in Live Cells Based on
Photon Counts and Complex Structure
Discrimination." Angew.Chem.Int.Ed.Engl.,
59, 9719-9726. doi: 10.1002/anie.202002422.
|
NMR solution structure of the 1:1 complex of tel26
g-quadruplex and a tripodal cationic fluorescent probe
nbte . ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUDU, hybrid1, 3+1, 3(-P-Lw-Ln)
|
|
6kfj
|
DNA |
NMR |
Liu LY, Liu W, Wang KN, Zhu BC, Xia XY, Ji LN, Mao
ZW |
(2020) "Quantitative
Detection of G-Quadruplex DNA in Live Cells Based on
Photon Counts and Complex Structure
Discrimination." Angew.Chem.Int.Ed.Engl.,
59, 9719-9726. doi: 10.1002/anie.202002422.
|
NMR solution structure of the 1:1 complex of wttel26
g-quadruplex and a tripodal cationic fluorescent probe
nbte . ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UDUU, hybrid3, 3+1, 3(-Lw-Ln-P)
|
|
6kfl
|
DNA |
X-ray (1.92 Å) |
Zhang YS, Parkinson GN, Wei DG |
"Crystal structure of a two-quartet DNA G-quadruplex
complexed with the porphyrin TMPyP4." |
Crystal structure of a two-quartet DNA g-quadruplex
complexed with the porphyrin tmpyp4 . ➥ 4
G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack,
UDUD, anti-parallel:chair, 2+2; UUUU, parallel, 4+0,
coaxial interfaces: mixed
|
|
6kn4
|
DNA |
NMR |
Barthwal R, Raje S, Pandav K |
(2021) "Structural
basis for stabilization of human telomeric G-quadruplex
[d-(TTAGGGT)] 4 by anticancer drug adriamycin."
J.Biomol.Struct.Dyn., 39,
795-815. doi: 10.1080/07391102.2020.1730969.
|
Human parallel stranded 7-mer g-quadruplex complexed
with 2 adriamycin (dm2) molecules . ➥ 3
G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel,
4+0
|
|
6kvb
|
DNA |
NMR |
Maity A, Winnerdy FR, Chang WD, Chen G, Phan AT |
(2020) "Intra-locked
G-quadruplex structures formed by irregular DNA G-rich
motifs." Nucleic Acids Res.,
48, 3315-3327. doi: 10.1093/nar/gkaa008.
|
Structure of an intra-locked g-quadruplex .
➥ 4 G-tetrads, 1 G4 helix
|
|
6kxz
|
DNA |
NMR |
Barthwal R, Raje S, Pandav K |
(2020) "Structural
basis for stabilization of human telomeric G-quadruplex
[d-(TTAGGGT)] 4 by anticancer drug epirubicin."
Bioorg.Med.Chem., 28, 115761.
doi: 10.1016/j.bmc.2020.115761.
|
Human parallel stranded 7-mer g-quadruplex complexed
with 2 epirubicin (epi) molecules . ➥ 3
G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel,
4+0
|
|
6l8m
|
DNA |
NMR |
Wang ZF, Li MH, Chu IT, Winnerdy FR, Phan AT, Chang
TC |
(2020) "Cytosine
epigenetic modification modulates the formation of an
unprecedented G4 structure in the WNT1 promoter."
Nucleic Acids Res., 48,
1120-1130. doi: 10.1093/nar/gkz1207.
|
Wnt DNA promoter mutant g-quadruplex . ➥ 3
G-tetrads, 1 G4 helix, 1 G4 stem, UDDD, hybrid4, 1+3,
2(-LwX+P)
|
|
6l92
|
DNA |
NMR |
Wang ZF, Li MH, Chu IT, Winnerdy FR, Phan AT, Chang
TC |
(2020) "Cytosine
epigenetic modification modulates the formation of an
unprecedented G4 structure in the WNT1 promoter."
Nucleic Acids Res., 48,
1120-1130. doi: 10.1093/nar/gkz1207.
|
A basket type g-quadruplex in wnt DNA promoter .
➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUD, hybrid2, 3+1, 3(+LnD-P)
|
|
6ldm
|
DNA binding protein-DNA |
X-ray (2.4 Å) |
Traczyk A, Liew CW, Gill DJ, Rhodes D |
(2020) "Structural
basis of G-quadruplex DNA recognition by the yeast
telomeric protein Rap1." Nucleic Acids
Res., 48, 4562-4571. doi:
10.1093/nar/gkaa171.
|
Structural basis of g-quadruplex DNA recognition by the
yeast telomeric protein rap1 . ➥ 3
G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0,
3(-P-P-P)
|
|
6lnz
|
DNA |
NMR |
Zhu BC, He J, Liu W, Xia XY, Liu LY, Liang BB, Yao
HG, Liu B, Ji LN, Mao ZW |
(2021) "Selectivity
and Targeting of G-Quadruplex Binders Activated by
Adaptive Binding and Controlled by Chemical
Kinetics." Angew.Chem.Int.Ed.Engl.,
60, 15340-15343. doi: 10.1002/anie.202104624.
|
NMR solution structure of vegf g-quadruplex bound a
non-planar cyclometalated-carbene platinum(ii) complex
. ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
6m05
|
DNA |
NMR |
Jing H, Fu W, Hu W, Xu S, Xu X, He M, Liu Y, Zhang
N |
(2021) "NMR
structural study on the self-trimerization of d(GTTAGG)
into a dynamic trimolecular G-quadruplex assembly
preferentially in Na+ solution with a moderate K+
tolerance." Nucleic Acids Res.,
49, 2306-2316. doi: 10.1093/nar/gkab028.
|
Trimolecular g-quadruplex . ➥
2 G-tetrads, 1 G4
helix
|
|
6n65
|
DNA |
X-ray (1.6 Å) |
Ou A, Schmidberger JW, Wilson KA, Evans CW,
Hargreaves JA, Grigg M, O'Mara ML, Iyer KS, Bond CS,
Smith NM |
(2020) "High
resolution crystal structure of a KRAS promoter
G-quadruplex reveals a dimer with extensive poly-A
pi-stacking interactions for small-molecule
recognition." Nucleic Acids Res.,
48, 5766-5776. doi: 10.1093/nar/gkaa262.
|
Kras g-quadruplex g16t mutant. . ➥ 6
G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack,
UUUU, parallel, 4+0, 3(-P-P-P), coaxial interfaces:
5'/5'
|
|
6neb
|
DNA |
NMR |
Dickerhoff J, Onel B, Chen L, Chen Y, Yang D |
(2019) "Solution
Structure of a MYC Promoter G-Quadruplex with 1:6:1
Loop Length." Acs Omega,
4, 2533-2539. doi: 10.1021/acsomega.8b03580.
|
Myc promoter g-quadruplex with 1:6:1 loop length .
➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
6o2l
|
DNA |
NMR |
Liu W, Lin C, Wu G, Dai J, Chang TC, Yang D |
(2019) "Structures
of 1:1 and 2:1 complexes of BMVC and MYC promoter
G-quadruplex reveal a mechanism of ligand conformation
adjustment for G4-recognition." Nucleic Acids
Res., 47, 11931-11942. doi:
10.1093/nar/gkz1015.
|
NMR structure of the 2:1 complex of a carbazole
derivative bmvc bound to c-myc g-quadruplex .
➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
6p45
|
DNA |
X-ray (2.339 Å) |
Lin LY, McCarthy S, Powell BM, Manurung Y, Xiang IM,
Dean WL, Chaires B, Yatsunyk LA |
(2020) "Biophysical
and X-ray structural studies of the (GGGTT)3GGG
G-quadruplex in complex with N-methyl mesoporphyrin
IX." Plos One, 15,
e0241513. doi: 10.1371/journal.pone.0241513.
|
Crystal structure of the g-quadruplex formed by
(tgggt)4 in complex with n-methylmesoporphryin ix .
➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
6pnk
|
DNA |
X-ray (2.39 Å) |
Lin LY, McCarthy S, Powell BM, Manurung Y, Xiang IM,
Dean WL, Chaires B, Yatsunyk LA |
(2020) "Biophysical
and X-ray structural studies of the (GGGTT)3GGG
G-quadruplex in complex with N-methyl mesoporphyrin
IX." Plos One, 15,
e0241513. doi: 10.1371/journal.pone.0241513.
|
Crystal structure of the g-quadruplex formed by
(gggtt)3ggg in complex with n-methylmesoporphryin ix .
➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
6pq7
|
RNA |
X-ray (3.0 Å) |
Trachman III RJ, Stagno JR, Conrad C, Jones CP,
Fischer P, Meents A, Wang YX, Ferre-D'Amare AR |
(2019) "Co-crystal
structure of the iMango-III fluorescent RNA aptamer
using an X-ray free-electron laser." Acta
Crystallogr.,Sect.F, 75, 547-551.
doi: 10.1107/S2053230X19010136.
|
Structure of the imango-iii fluorescent aptamer at room
temperature. . ➥ 2 G-tetrads, 1 G4 helix, 1 G4
stem, UUUD, hybrid2, 3+1, 2(-P-P-Lw)
|
|
6q6r
|
DNA binding protein |
X-ray (1.5 Å) |
Heddi B, Cheong VV, Schmitt E, Mechulam Y, Phan
AT |
(2020) "Recognition
of different base tetrads by RHAU (DHX36): X-ray
crystal structure of the G4 recognition motif bound to
the 3'-end tetrad of a DNA G-quadruplex."
J.Struct.Biol., 209, 107399.
doi: 10.1016/j.jsb.2019.10.001.
|
Recognition of different base tetrads by rhau: x-ray
crystal structure of g4 recognition motif bound to the
3-end tetrad of a DNA g-quadruplex . ➥ 12
G-tetrads, 2 G4 helices, 4 G4 stems, 2 G4 coaxial
stacks, UUUU, parallel, 4+0, 3(-P-P-P), coaxial
interfaces: 5'/5'
|
|
6qjo
|
DNA |
X-ray (1.8 Å) |
Winnerdy FR, Bakalar B, Maity A, Vandana JJ, Mechulam
Y, Schmitt E, Phan AT |
(2019) "NMR
solution and X-ray crystal structures of a DNA molecule
containing both right- and left-handed
parallel-stranded G-quadruplexes." Nucleic
Acids Res., 47, 8272-8281. doi:
10.1093/nar/gkz349.
|
DNA containing both right- and left-handed
parallel-stranded g-quadruplexes . ➥ 4
G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0,
2(-P-P-P)
|
|
6r9k
|
DNA |
NMR |
Karg B, Mohr S, Weisz K |
(2019) "Duplex-Guided
Refolding into Novel G-Quadruplex (3+1) Hybrid
Conformations." Angew.Chem.Int.Ed.Engl.,
58, 11068-11071. doi: 10.1002/anie.201905372.
|
A quadruplex hybrid structure with lpp loop orientation
and 3 syn residues . ➥
3 G-tetrads, 1 G4 helix,
1 G4 stem, UDDD, hybrid4, 1+3, 3(+Ln+P+P)
|
|
6r9l
|
DNA |
NMR |
Karg B, Mohr S, Weisz K |
(2019) "Duplex-Guided
Refolding into Novel G-Quadruplex (3+1) Hybrid
Conformations." Angew.Chem.Int.Ed.Engl.,
58, 11068-11071. doi: 10.1002/anie.201905372.
|
A quadruplex hybrid structure with lpp loop orientation
and 5 syn residues . ➥
3 G-tetrads, 1 G4 helix,
1 G4 stem, UDDD, hybrid4, 1+3, 3(+Ln+P+P)
|
|
6rnl
|
DNA |
X-ray (1.88 Å) |
McQuaid K, Hall JP, Baumgaertner L, Cardin DJ, Cardin
CJ |
(2019) "Three
thymine/adenine binding modes of the ruthenium complex
Lambda-[Ru(TAP)2(dppz)]2+to the G-quadruplex forming
sequence d(TAGGGTT) shown by X-ray
crystallography." Chem.Commun.(Camb.),
55, 9116-9119. doi: 10.1039/c9cc04316k.
|
L-[ru(tap)2(dppz)]2+ bound to the g-quadruplex forming
sequence d(tagggtt) . ➥
3 G-tetrads, 1 G4 helix,
1 G4 stem, UUUU, parallel, 4+0
|
|
6rs3
|
DNA |
NMR |
Haase L, Dickerhoff J, Weisz K |
(2020) "Sugar
Puckering Drives G-Quadruplex Refolding: Implications
for V-Shaped Loops." Chemistry,
26, 524-533. doi: 10.1002/chem.201904044.
|
2'-f-riboguanosine modified g-quadruplex with v-loop .
➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UDDD, hybrid4, 1+3, 2(-LwX+P)
|
|
6s15
|
DNA |
X-ray (1.7 Å) |
Papi F, Bazzicalupi C, Ferraroni M, Ciolli G,
Lombardi P, Khan AY, Kumar GS, Gratteri P |
(2020) "Pyridine
Derivative of the Natural Alkaloid Berberine as Human
Telomeric G4-DNA Binder: A Solution and Solid-State
Study." Acs Med.Chem.Lett.,
11, 645-650. doi: 10.1021/acsmedchemlett.9b00516.
|
Pyridine derivative of the natural alkaloid berberine
as human telomeric g-quadruplex binder . ➥ 3
G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel,
4+0
|
|
6suu
|
DNA |
NMR |
Marquevielle J, Robert C, Lagrabette O, Wahid M,
Bourdoncle A, Xodo LE, Mergny JL, Salgado GF |
(2020) "Structure
of two G-quadruplexes in equilibrium in the KRAS
promoter." Nucleic Acids Res.,
48, 9336-9345. doi: 10.1093/nar/gkaa387.
|
NMR structure of kras32r g9t conformer g-quadruplex
within kras promoter region . ➥ 3
G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0,
2(-P-P-P)
|
|
6sx6
|
DNA |
NMR |
Pavc D, Wang B, Spindler L, Drevensek-Olenik I,
Plavec J, Sket P |
(2020) "GC ends
control topology of DNA G-quadruplexes and their
cation-dependent assembly." Nucleic Acids
Res., 48, 2749-2761. doi:
10.1093/nar/gkaa058.
|
Guanine-rich oligonucleotide with 5'-gc end form
g-quadruplex with a(gggg)a hexad, gcgc- and g-quartets
and two symmetric gg and aa base pairs . ➥ 3
G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel,
4+0
|
|
6syk
|
DNA |
NMR |
Pavc D, Wang B, Spindler L, Drevensek-Olenik I,
Plavec J, Sket P |
(2020) "GC ends
control topology of DNA G-quadruplexes and their
cation-dependent assembly." Nucleic Acids
Res., 48, 2749-2761. doi:
10.1093/nar/gkaa058.
|
Guanine-rich oligonucleotide with 5'- and 3'-gc ends
form g-quadruplex with a(gggg)a hexad, gcgc- and
g-quartets and two symmetric gg and aa base pair .
➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0
|
|
6t2g
|
DNA |
NMR |
Marquevielle J, Robert C, Lagrabette O, Wahid M,
Bourdoncle A, Xodo LE, Mergny JL, Salgado GF |
(2020) "Structure
of two G-quadruplexes in equilibrium in the KRAS
promoter." Nucleic Acids Res.,
48, 9336-9345. doi: 10.1093/nar/gkaa387.
|
NMR structure of kras32r g25t conformer g-quadruplex
within kras promoter region . ➥ 3
G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0,
3(-P-P-P)
|
|
6t51
|
DNA |
NMR |
Marquevielle J, Kumar MVV, Mergny JL, Salgado GF |
(2018) "1H,13C,
and15N chemical shift assignments of a G-quadruplex
forming sequence within the KRAS proto-oncogene
promoter region." Biomol.Nmr Assign.,
12, 123-127. doi: 10.1007/s12104-017-9793-0.
|
NMR structure of kras22rt g-quadruplex forming within
kras promoter region at physological temperature .
➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
6tc8
|
DNA |
NMR |
Haase L, Weisz K |
(2020) "Switching
the type of V-loop in sugar-modified G-quadruplexes
through altered fluorine interactions."
Chem.Commun.(Camb.), 56,
4539-4542. doi: 10.1039/d0cc01285h.
|
2'-f-arabinoguanosine and 2'-f-riboguanosine modified
hybrid type g-quadruplex with v-loop . ➥ 3
G-tetrads, 1 G4 helix, 1 G4 stem, UDDD, hybrid4, 1+3,
2(-LwX+P)
|
|
6tcg
|
DNA |
NMR |
Haase L, Weisz K |
(2020) "Switching
the type of V-loop in sugar-modified G-quadruplexes
through altered fluorine interactions."
Chem.Commun.(Camb.), 56,
4539-4542. doi: 10.1039/d0cc01285h.
|
2'-f-riboguanosine and 2'-f-arabinoguanosine modified
g-quadruplex with v-loop and all-syn g-tract .
➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UDDD, hybrid4, 1+3, 2(-LwX+P)
|
|
6tzq
|
DNA |
X-ray (2.29 Å) |
Chu B, Zhang D, Paukstelis PJ |
(2019) "A DNA
G-quadruplex/i-motif hybrid." Nucleic Acids
Res., 47, 11921-11930. doi:
10.1093/nar/gkz1008.
|
A DNA g-quadruplex-i-motif hybrid . ➥ 2
G-tetrads, 1 G4 helix, 1 G4 stem, UDUD,
anti-parallel:chair, 2+2
|
|
6tzr
|
DNA |
X-ray (2.4 Å) |
Chu B, Zhang D, Paukstelis PJ |
(2019) "A DNA
G-quadruplex/i-motif hybrid." Nucleic Acids
Res., 47, 11921-11930. doi:
10.1093/nar/gkz1008.
|
A DNA g-quadruplex-i-motif hybrid . ➥ 2
G-tetrads, 1 G4 helix, 1 G4 stem, UDUD,
anti-parallel:chair, 2+2
|
|
6up0
|
RNA |
X-ray (2.8 Å) |
Jeng SCY, Trachman III RJ, Weissenboeck F, Truong L,
Link KA, Jepsen MDE, Knutson JR, Andersen ES,
Ferre-D'Amare AR, Unrau PJ |
(2021) "Fluorogenic
aptamers resolve the flexibility of RNA junctions using
orientation-dependent FRET." Rna,
27, 433-444. doi: 10.1261/rna.078220.120.
|
Structure of the mango-iii fluorescent aptamer bound to
yo3-biotin . ➥ 2 G-tetrads, 1 G4 helix, 1 G4
stem, UUUD, hybrid2, 3+1, 2(-P-P-Lw)
|
|
6v0l
|
DNA |
NMR |
Wang KB, Dickerhoff J, Wu G, Yang D |
(2020) "PDGFR-beta
Promoter Forms a Vacancy G-Quadruplex that Can Be
Filled in by dGMP: Solution Structure and Molecular
Recognition of Guanine Metabolites and Drugs."
J.Am.Chem.Soc., 142,
5204-5211. doi: 10.1021/jacs.9b12770.
|
Pdgfr-b promoter forms a g-vacancy quadruplex that can
be complemented by dgmp: molecular structure and
recognition of guanine derivatives and metabolites .
➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 2(-P-P-P)
|
|
6v9b
|
RNA |
X-ray (2.4 Å) |
Trachman 3rd RJ, Cojocaru R, Wu D, Piszczek G,
Ryckelynck M, Unrau PJ, Ferre-D'Amare AR |
(2020) "Structure-Guided
Engineering of the Homodimeric Mango-IV Fluorescence
Turn-on Aptamer Yields an RNA FRET Pair."
Structure, 28, 776-785.e3.
doi: 10.1016/j.str.2020.04.007.
|
Co-crystal structure of the fluorogenic mango-iv
homodimer bound to to1-biotin . ➥ 6
G-tetrads, 2 G4 helices, 2 G4 stems, UUUU, parallel,
4+0, 3(-P-P-P)
|
|
6v9d
|
RNA |
X-ray (2.8 Å) |
Trachman 3rd RJ, Cojocaru R, Wu D, Piszczek G,
Ryckelynck M, Unrau PJ, Ferre-D'Amare AR |
(2020) "Structure-Guided
Engineering of the Homodimeric Mango-IV Fluorescence
Turn-on Aptamer Yields an RNA FRET Pair."
Structure, 28, 776-785.e3.
doi: 10.1016/j.str.2020.04.007.
|
Co-crystal structure of the fluorogenic mango-iv
homodimer bound to to1-biotin . ➥ 6
G-tetrads, 2 G4 helices, 2 G4 stems, UUUU, parallel,
4+0, 3(-P-P-P)
|
|
6w9p
|
DNA |
X-ray (1.99 Å) |
Beseiso D, Chen EV, McCarthy SE, Martin KN, Gallagher
EP, Miao J, Yatsunyk LA |
(2022) "The
first crystal structures of hybrid and parallel
four-tetrad intramolecular G-quadruplexes."
Nucleic Acids Res., 50,
2959-2972. doi: 10.1093/nar/gkac091.
|
Tel26 parallel four-quartet g-quadruplex with k+ .
➥ 4 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 4(-P-P-P)
|
|
6wck
|
DNA |
X-ray (1.801 Å) |
Ou A, Schmidberger JW, Wilson KA, Evans CW,
Hargreaves JA, Grigg M, O'Mara ML, Iyer KS, Bond CS,
Smith NM |
(2020) "High
resolution crystal structure of a KRAS promoter
G-quadruplex reveals a dimer with extensive poly-A
pi-stacking interactions for small-molecule
recognition." Nucleic Acids Res.,
48, 5766-5776. doi: 10.1093/nar/gkaa262.
|
Kras g-quadruplex g16t mutant with bromo uracil
replacing t8 and t16. . ➥
6 G-tetrads, 1 G4 helix,
2 G4 stems, 1 G4 coaxial stack, UUUU, parallel, 4+0,
3(-P-P-P), coaxial interfaces: 5'/5'
|
|
6xcl
|
DNA |
X-ray (2.7 Å) |
Miron CE, van Staalduinen L, Rangaswamy AM, Chen M,
Liang Y, Jia Z, Mergny JL, Petitjean A |
(2021) "Going
Platinum to the Tune of a Remarkable Guanine Quadruplex
Binder: Solution- and Solid-State Investigations."
Angew.Chem.Int.Ed.Engl., 60,
2500-2507. doi: 10.1002/anie.202012520.
|
Crystal structure of human telomeric DNA g-quadruplex
in complex with a novel platinum(ii) complex. .
➥ 6 G-tetrads, 1 G4 helix, 2 G4
stems, 1 G4 coaxial stack, UUUU, parallel, 4+0,
3(-P-P-P), coaxial interfaces: 5'/5'
|
|
6xrq
|
RNA |
X-ray (1.21 Å) |
Zhang Y, Bux K, Attana F, Wei D, Haider S, Parkinson
GN |
(2024) "Structural
descriptions of ligand interactions to RNA quadruplexes
folded from the non-coding region of Pseudorabies
virus." Biochimie. doi: 10.1016/j.biochi.2024.06.003.
|
Structural descriptions of ligand interactions to DNA
and RNA quadruplexes folded from the non-coding region
of pseudorabies virus . ➥
4 G-tetrads, 1 G4 helix,
2 G4 stems, 1 G4 coaxial stack, UUUU, parallel, 4+0,
coaxial interfaces: 3'/5'
|
|
6xt7
|
DNA |
X-ray (1.56 Å) |
Beseiso D, Chen EV, McCarthy SE, Martin KN, Gallagher
EP, Miao J, Yatsunyk LA |
(2022) "The
first crystal structures of hybrid and parallel
four-tetrad intramolecular G-quadruplexes."
Nucleic Acids Res., 50,
2959-2972. doi: 10.1093/nar/gkac091.
|
Tel25 hybrid four-quartet g-quadruplex with k+ .
➥ 16 G-tetrads, 4 G4 helices, 4 G4
stems, UUDU, hybrid1, 3+1, 3(-P-Lw-Ln)
|
|
6ycv
|
DNA |
NMR |
Haase L, Weisz K |
(2020) "Locked
nucleic acid building blocks as versatile tools for
advanced G-quadruplex design." Nucleic Acids
Res., 48, 10555-10566. doi:
10.1093/nar/gkaa720.
|
2'-f-riboguanosine and lna modified hybrid type
g-quadruplex with v-loop . ➥
3 G-tetrads, 1 G4 helix,
1 G4 stem, UDDD, hybrid4, 1+3, 2(-LwX+P)
|
|
6yep
|
DNA |
NMR |
Haase L, Weisz K |
(2020) "Locked
nucleic acid building blocks as versatile tools for
advanced G-quadruplex design." Nucleic Acids
Res., 48, 10555-10566. doi:
10.1093/nar/gkaa720.
|
Lna modified g-quadruplex with flipped g-tract and
central tetrad . ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUDD, anti-parallel:basket2, 2+2, 3(+LnD-Lw)
|
|
6yy4
|
DNA |
NMR |
Volek M, Kolesnikova S, Svehlova K, Srb P, Sgallova
R, Streckerova T, Redondo JA, Veverka V, Curtis EA |
(2021) "Overlapping
but distinct: a new model for G-quadruplex biochemical
specificity." Nucleic Acids Res.,
49, 1816-1827. doi: 10.1093/nar/gkab037.
|
Parallel 17-mer DNA g-quadruplex . ➥ 3
G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0,
3(-P-P-P)
|
|
6z8v
|
hydrolase |
X-ray (1.58 Å) |
Smirnov I, Kolganova N, Troisi R, Sica F, Timofeev
E |
(2021) "Expanding
the recognition interface of the thrombin-binding
aptamer HD1 through modification of residues T3 and
T12." Mol Ther Nucleic Acids,
23, 863-871. doi: 10.1016/j.omtn.2021.01.004.
|
X-ray structure of the complex between human alpha
thrombin and a thrombin binding aptamer variant
(tba-3l), which contains 1-beta-d-lactopyranosyl
residue in the side chain of thy3 at n3. . ➥ 2
G-tetrads, 1 G4 helix, 1 G4 stem, UDUD,
anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
|
|
6z8w
|
hydrolase |
X-ray (1.73 Å) |
Smirnov I, Kolganova N, Troisi R, Sica F, Timofeev
E |
(2021) "Expanding
the recognition interface of the thrombin-binding
aptamer HD1 through modification of residues T3 and
T12." Mol Ther Nucleic Acids,
23, 863-871. doi: 10.1016/j.omtn.2021.01.004.
|
X-ray structure of the complex between human alpha
thrombin and a thrombin binding aptamer variant
(tba-3g), which contains 1-beta-d-glucopyranosyl
residue in the side chain of thy3 at n3. . ➥ 2
G-tetrads, 1 G4 helix, 1 G4 stem, UDUD,
anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
|
|
6z8x
|
hydrolase |
X-ray (2.53 Å) |
Smirnov I, Kolganova N, Troisi R, Sica F, Timofeev
E |
(2021) "Expanding
the recognition interface of the thrombin-binding
aptamer HD1 through modification of residues T3 and
T12." Mol Ther Nucleic Acids,
23, 863-871. doi: 10.1016/j.omtn.2021.01.004.
|
X-ray structure of the complex between human alpha
thrombin and a thrombin binding aptamer variant
(tba-3leu), which contains leucyl amide in the side
chain of thy3 at n3. . ➥
2 G-tetrads, 1 G4 helix,
1 G4 stem, UDUD, anti-parallel:chair, 2+2,
2(+Ln+Ln)
|
|
6zl2
|
DNA |
NMR |
Vianney YM, Preckwinkel P, Mohr S, Weisz K |
(2020) "Quadruplex-Duplex
Junction: A High-Affinity Binding Site for
Indoloquinoline Ligands." Chemistry,
26, 16910-16922. doi: 10.1002/chem.202003540.
|
Structure of a parallel c-myc modified with 3' duplex
stem-loop overhang . ➥
3 G-tetrads, 1 G4 helix,
1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
6zl9
|
DNA |
NMR |
Vianney YM, Preckwinkel P, Mohr S, Weisz K |
(2020) "Quadruplex-Duplex
Junction: A High-Affinity Binding Site for
Indoloquinoline Ligands." Chemistry,
26, 16910-16922. doi: 10.1002/chem.202003540.
|
Structure of a parallel c-myc modified with 5' duplex
stem-loop overhang . ➥
3 G-tetrads, 1 G4 helix,
1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
6zrm
|
DNA |
NMR |
Lenarcic Zivkovic M, Rozman J, Plavec J |
(2020) "Structure
of a DNA G-Quadruplex Related to Osteoporosis with a
G-A Bulge Forming a Pseudo-loop ."
Molecules, 25. doi: 10.3390/molecules25204867.
|
G-quadruplex with a g-a bulge . ➥ 3
G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0,
3(-P-P-P)
|
|
6zte
|
DNA |
NMR |
Vianney YM, Preckwinkel P, Mohr S, Weisz K |
(2020) "Quadruplex-Duplex
Junction: A High-Affinity Binding Site for
Indoloquinoline Ligands." Chemistry,
26, 16910-16922. doi: 10.1002/chem.202003540.
|
Structure of a parallel c-myc modified with 5' duplex
stem-loop and 3' diagonal snap-back loop . ➥ 3
G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0,
2(-P-P-P)
|
|
6zx6
|
DNA |
NMR |
Bielskute S, Plavec J, Podbevsek P |
(2021) "Oxidative
lesions modulate G-quadruplex stability and structure
in the human BCL2 promoter." Nucleic Acids
Res., 49, 2346-2356. doi:
10.1093/nar/gkab057.
|
Antiparallel basket-type g-quadruplex DNA structure
formed in human bcl-2 promoter containing 8-oxog .
➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UDDU, anti-parallel:basket, 2+2, 3(-LwD+Ln)
|
|
6zx7
|
DNA |
NMR |
Bielskute S, Plavec J, Podbevsek P |
(2021) "Oxidative
lesions modulate G-quadruplex stability and structure
in the human BCL2 promoter." Nucleic Acids
Res., 49, 2346-2356. doi:
10.1093/nar/gkab057.
|
Antiparallel basket-type g-quadruplex DNA structure
formed in human bcl-2 promoter . ➥ 3
G-tetrads, 1 G4 helix, 1 G4 stem, UDDU,
anti-parallel:basket, 2+2, 3(-LwD+Ln)
|
|
7alu
|
DNA |
NMR |
De Rache A, Marquevielle J, Bouaziz S, Vialet B,
Andreola ML, Mergny JL, Amrane S |
(2023) "Structure
of a DNA G-quadruplex that modulates SP1 binding sites
architecture in HIV-1 promoter."
J.Mol.Biol., 168359. doi: 10.1016/j.jmb.2023.168359.
|
NMR structure of a DNA g-quadruplex containing two sp1
binding sites from hiv-1 promoter . ➥ 3
G-tetrads, 1 G4 helix, 1 G4 stem, UDUU, hybrid3, 3+1,
3(-Lw-Ln-P)
|
|
7atz
|
DNA |
NMR |
Vianney YM, Weisz K |
(2021) "First
Tandem Repeat of a Potassium Channel KCNN4
Minisatellite Folds into a V-Loop G-Quadruplex
Structure." Biochemistry,
60, 1337-1346. doi: 10.1021/acs.biochem.1c00043.
|
G-quadruplex with v-shaped loop from the first repeat
of kcnn4 minisatellite . ➥
3 G-tetrads, 1 G4 helix,
1 G4 stem, UDDD, hybrid4, 1+3, 2(-LwX+P)
|
|
7cls
|
DNA |
NMR |
Ngoc Nguyen TQ, Lim KW, Phan AT |
(2020) "Duplex
formation in a G-quadruplex bulge." Nucleic
Acids Res., 48, 10567-10575. doi:
10.1093/nar/gkaa738.
|
Solution structure of an intramolecular g-quadruplex
containing a duplex bulge . ➥
3 G-tetrads, 1 G4 helix,
1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
7cps
|
DNA |
NMR |
Barthwal R, Tariq Z, Pandav K |
"A 2:1 stoichiometric complex of anticancer drug
4'-Epiadriamycin bound to parallel G-quadruplex DNA
[d-(TTGGGGT)]4." |
A 2:1 stoichiometric complex of anticancer drug
4'-epiadriamycin bound to parallel g-quadruplex DNA
[d-(ttggggt)]4. . ➥ 4 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0
|
|
7csk
|
DNA |
NMR |
Barthwal R, Tariq Z, Pandav K |
"A 2:1 stoichiometric complex of anticancer drug
Adriamycin bound to parallel G-quadruplex DNA
[d-(TTGGGGT)]4." |
A 2:1 stoichiometric complex of anticancer drug
adriamycin bound to parallel g-quadruplex DNA
[d-(ttggggt)]4. . ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0
|
|
7cv3
|
DNA |
NMR |
Tan DJY, Winnerdy FR, Lim KW, Phan AT |
(2020) "Coexistence
of two quadruplex-duplex hybrids in the PIM1 gene."
Nucleic Acids Res., 48,
11162-11171. doi: 10.1093/nar/gkaa752.
|
Quadruplex-duplex hybrid structure in the pim1 gene,
form 1 . ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUDU, hybrid1, 3+1, 3(-P-Lw-Ln)
|
|
7cv4
|
DNA |
NMR |
Tan DJY, Winnerdy FR, Lim KW, Phan AT |
(2020) "Coexistence
of two quadruplex-duplex hybrids in the PIM1 gene."
Nucleic Acids Res., 48,
11162-11171. doi: 10.1093/nar/gkaa752.
|
Quadruplex-duplex hybrid structure in the pim1 gene,
form 2 . ➥ 2 G-tetrads, 1 G4 helix, 1 G4
stem, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
|
|
7d31
|
DNA |
X-ray (1.396 Å) |
Liu H, Gao Y, Mathivanan J, Shen F, Chen X, Li Y,
Shao Z, Zhang Y, Shao Q, Sheng J, Gan J |
(2022) "Structure-guided
development of Pb 2+ -binding DNA aptamers."
Sci Rep, 12, 460. doi:
10.1038/s41598-021-04243-2.
|
The tba-pb2+ complex in p41212 space group .
➥ 4 G-tetrads, 2 G4 helices, 2 G4
stems, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
|
|
7d32
|
DNA |
X-ray (1.707 Å) |
Liu H, Gao Y, Mathivanan J, Shen F, Chen X, Li Y,
Shao Z, Zhang Y, Shao Q, Sheng J, Gan J |
(2022) "Structure-guided
development of Pb 2+ -binding DNA aptamers."
Sci Rep, 12, 460. doi:
10.1038/s41598-021-04243-2.
|
The tba-pb2+ complex in p41212 space group .
➥ 4 G-tetrads, 2 G4 helices, 2 G4
stems, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
|
|
7d33
|
DNA |
X-ray (2.117 Å) |
Liu H, Gao Y, Mathivanan J, Shen F, Chen X, Li Y,
Shao Z, Zhang Y, Shao Q, Sheng J, Gan J |
(2022) "Structure-guided
development of Pb 2+ -binding DNA aptamers."
Sci Rep, 12, 460. doi:
10.1038/s41598-021-04243-2.
|
The pb2+ complexed structure of tba g8c mutant .
➥ 4 G-tetrads, 2 G4 helices, 2 G4
stems, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
|
|
7d5d
|
DNA |
X-ray (1.18 Å) |
Das P, Ngo KH, Winnerdy FR, Maity A, Bakalar B,
Mechulam Y, Schmitt E, Phan AT |
(2021) "Bulges
in left-handed G-quadruplexes." Nucleic Acids
Res., 49, 1724-1736. doi:
10.1093/nar/gkaa1259.
|
Left-handed g-quadruplex containing one bulge .
➥ 4 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 2(+P+P+P), negative
twist
|
|
7d5e
|
DNA |
X-ray (1.296 Å) |
Das P, Ngo KH, Winnerdy FR, Maity A, Bakalar B,
Mechulam Y, Schmitt E, Phan AT |
(2021) "Bulges
in left-handed G-quadruplexes." Nucleic Acids
Res., 49, 1724-1736. doi:
10.1093/nar/gkaa1259.
|
Left-handed g-quadruplex containing two bulges .
➥ 4 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 2(+P+P+P), negative
twist
|
|
7d5f
|
DNA |
NMR |
Das P, Ngo KH, Winnerdy FR, Maity A, Bakalar B,
Mechulam Y, Schmitt E, Phan AT |
(2021) "Bulges
in left-handed G-quadruplexes." Nucleic Acids
Res., 49, 1724-1736. doi:
10.1093/nar/gkaa1259.
|
Left-handed g-quadruplex containing 3 bulges .
➥ 4 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 2(+P+P+P), negative
twist
|
|
7dfy
|
DNA |
X-ray (1.69 Å) |
Das P, Winnerdy FR, Maity A, Mechulam Y, Phan AT |
(2021) "A novel
minimal motif for left-handed G-quadruplex
formation." Chem.Commun.(Camb.),
57, 2527-2530. doi: 10.1039/d0cc08146a.
|
Novel motif for left-handed g-quadruplex formation .
➥ 8 G-tetrads, 2 G4 helices, 4 G4
stems, 2 G4 coaxial stacks, UUUU, parallel, 4+0,
2(+P+P+P), coaxial interfaces: 3'/3', negative
twist
|
|
7do1
|
DNA |
NMR |
Fu W, Jing H, Xu X, Xu S, Wang T, Hu W, Li H, Zhang
N |
(2021) "Two
coexisting pseudo-mirror heteromolecular telomeric
G-quadruplexes in opposite loop progressions
differentially recognized by a low equivalent of
Thioflavin T." Nucleic Acids Res.,
49, 10717-10734. doi: 10.1093/nar/gkab755.
|
Solution structure of a heteromolecular telomeric (3+1)
g-quadruplex containing right loop progression .
➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UDUU, hybrid3, 3+1
|
|
7e5p
|
DNA |
NMR |
Tsukakoshi K, Yamagishi Y, Kanazashi M, Nakama K,
Oshikawa D, Savory N, Matsugami A, Hayashi F, Lee J,
Saito T, Sode K, Khunathai K, Kuno H, Ikebukuro K |
(2021) "G-quadruplex-forming
aptamer enhances the peroxidase activity of myoglobin
against luminol." Nucleic Acids Res.,
49, 6069-6081. doi: 10.1093/nar/gkab388.
|
Aptamer enhancing peroxidase activity of myoglobin .
➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
7ecf
|
DNA |
X-ray (1.6 Å) |
Geng Y, Liu C, Cai Q, Luo Z, Miao H, Shi X, Xu N,
Fung CP, Choy TT, Yan B, Li N, Qian P, Zhou B, Zhu G |
(2021) "Crystal
structure of parallel G-quadruplex formed by the
two-repeat ALS- and FTD-related GGGGCC sequence."
Nucleic Acids Res., 49,
5881-5890. doi: 10.1093/nar/gkab302.
|
Crystal structure of d(g4c2)2-ba in c2221 space group .
➥ 8 G-tetrads, 1 G4 helix, 2 G4
stems, 1 G4 coaxial stack, UUUU, parallel, 4+0, coaxial
interfaces: 5'/5'
|
|
7ecg
|
DNA |
X-ray (1.97 Å) |
Geng Y, Liu C, Cai Q, Luo Z, Miao H, Shi X, Xu N,
Fung CP, Choy TT, Yan B, Li N, Qian P, Zhou B, Zhu G |
(2021) "Crystal
structure of parallel G-quadruplex formed by the
two-repeat ALS- and FTD-related GGGGCC sequence."
Nucleic Acids Res., 49,
5881-5890. doi: 10.1093/nar/gkab302.
|
Crystal structure of d(g4c2)2-ba in f222 space group .
➥ 8 G-tetrads, 1 G4 helix, 2 G4
stems, 1 G4 coaxial stack, UUUU, parallel, 4+0, coaxial
interfaces: 5'/5'
|
|
7ech
|
DNA |
X-ray (2.38 Å) |
Geng Y, Liu C, Cai Q, Luo Z, Miao H, Shi X, Xu N,
Fung CP, Choy TT, Yan B, Li N, Qian P, Zhou B, Zhu G |
(2021) "Crystal
structure of parallel G-quadruplex formed by the
two-repeat ALS- and FTD-related GGGGCC sequence."
Nucleic Acids Res., 49,
5881-5890. doi: 10.1093/nar/gkab302.
|
Crystal structure of d(g4c2)2-k in f222 space group .
➥ 8 G-tetrads, 1 G4 helix, 2 G4
stems, 1 G4 coaxial stack, UUUU, parallel, 4+0, coaxial
interfaces: 5'/5'
|
|
7el7
|
DNA |
NMR |
Liu LY, Wang KN, Liu W, Zeng YL, Hou MX, Yang J, Mao
ZW |
(2021) "Spatial
Matching Selectivity and Solution Structure of
Organic-Metal Hybrid to Quadruplex-Duplex Hybrid."
Angew.Chem.Int.Ed.Engl., 60,
20833-20839. doi: 10.1002/anie.202106256.
|
NMR solution structure of the 1:1 complex of a
quadruplex-duplex hybrid myt1l and a platinum(ii)
ligand l1pt(dien) . ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UDUU, hybrid3, 3+1, 3(-Lw-Ln-P)
|
|
7euc
|
DNA |
NMR |
Devi G, Winnerdy FR, Ang JCY, Lim KW, Phan AT |
(2022) "Four-Layered
Intramolecular Parallel G-Quadruplex with
Non-Nucleotide Loops: An Ultra-Stable Self-Folded DNA
Nano-Scaffold." Acs Nano,
16, 533-540. doi: 10.1021/acsnano.1c07630.
|
Parallel g-quadruplex structure . ➥ 4
G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel,
4+0
|
|
7jku
|
DNA |
X-ray (1.97 Å) |
Beseiso D, Chen EV, McCarthy SE, Martin KN, Gallagher
EP, Miao J, Yatsunyk LA |
(2022) "The
first crystal structures of hybrid and parallel
four-tetrad intramolecular G-quadruplexes."
Nucleic Acids Res., 50,
2959-2972. doi: 10.1093/nar/gkac091.
|
Crystal structure of a four-tetrad, parallel, and k+
stabilized tetrahymena thermophila telomeric
g-quadruplex . ➥ 4 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 4(-P-P-P)
|
|
7kbv
|
DNA |
NMR |
Dickerhoff J, Dai J, Yang D |
(2021) "Structural
recognition of the MYC promoter G-quadruplex by a
quinoline derivative: insights into molecular targeting
of parallel G-quadruplexes." Nucleic Acids
Res., 49, 5905-5915. doi:
10.1093/nar/gkab330.
|
Solution structure of the major myc promoter
g-quadruplex with a wild-type flanking sequence .
➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
7kbw
|
DNA |
NMR |
Dickerhoff J, Dai J, Yang D |
(2021) "Structural
recognition of the MYC promoter G-quadruplex by a
quinoline derivative: insights into molecular targeting
of parallel G-quadruplexes." Nucleic Acids
Res., 49, 5905-5915. doi:
10.1093/nar/gkab330.
|
Solution structure of the major myc promoter
g-quadruplex with a wild-type flanking in complex with
nsc85697, a quinoline derivative . ➥ 3
G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0,
3(-P-P-P)
|
|
7kbx
|
DNA |
NMR |
Dickerhoff J, Dai J, Yang D |
(2021) "Structural
recognition of the MYC promoter G-quadruplex by a
quinoline derivative: insights into molecular targeting
of parallel G-quadruplexes." Nucleic Acids
Res., 49, 5905-5915. doi:
10.1093/nar/gkab330.
|
Solution structure of the major myc promoter
g-quadruplex in complex with nsc85697, a quinoline
derivative . ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
7klp
|
DNA |
X-ray (1.35 Å) |
Li K, Yatsunyk L, Neidle S |
(2021) "Water
spines and networks in G-quadruplex structures."
Nucleic Acids Res., 49,
519-528. doi: 10.1093/nar/gkaa1177.
|
Crystal structure of a three-tetrad, parallel, k+
stabilized human telomeric g-quadruplex . ➥ 3
G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0,
3(-P-P-P)
|
|
7l0z
|
RNA |
X-ray (2.1 Å) |
Jeng SCY, Trachman III RJ, Weissenboeck F, Truong L,
Link KA, Jepsen MDE, Knutson JR, Andersen ES,
Ferre-D'Amare AR, Unrau PJ |
(2021) "Fluorogenic
aptamers resolve the flexibility of RNA junctions using
orientation-dependent FRET." Rna,
27, 433-444. doi: 10.1261/rna.078220.120.
|
Spinach variant bound to dfhbi-1t . ➥ 2
G-tetrads, 1 G4 helix, 1 G4 stem, UUDD,
anti-parallel:basket2, 2+2, 2(-PD+P)
|
|
7ll0
|
DNA |
X-ray (2.0 Å) |
Beseiso D, Chen EV, McCarthy SE, Martin KN, Gallagher
EP, Miao J, Yatsunyk LA |
(2022) "The
first crystal structures of hybrid and parallel
four-tetrad intramolecular G-quadruplexes."
Nucleic Acids Res., 50,
2959-2972. doi: 10.1093/nar/gkac091.
|
Crystal structure of a four-tetrad, parallel, and k+
stabilized tetrahymena thermophila telomeric
g-quadruplex . ➥ 4 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 4(-P-P-P)
|
|
7mkt
|
RNA |
X-ray (1.97 Å) |
Roschdi S, Yan J, Nomura Y, Escobar CA, Petersen RJ,
Bingman CA, Tonelli M, Vivek R, Montemayor EJ, Wickens M,
Kennedy SG, Butcher SE |
(2022) "An
atypical RNA quadruplex marks RNAs as vectors for gene
silencing." Nat.Struct.Mol.Biol.,
29, 1113-1121. doi: 10.1038/s41594-022-00854-z.
|
Crystal structure of r(gu)11g-nmm complex .
➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 2(-P-P-P)
|
|
7msv
|
DNA |
NMR |
Wang KB, Dickerhoff J, Yang D |
(2021) "Solution
Structure of Ternary Complex of Berberine Bound to a
dGMP-Fill-In Vacancy G-Quadruplex Formed in the
PDGFR-beta Promoter." J.Am.Chem.Soc.,
143, 16549-16555. doi: 10.1021/jacs.1c06200.
|
Solution structure of berberine bound to a dgmp fill-in
g-quadruplex in the pdgfr-b promoter . ➥ 3
G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0,
2(-P-P-P)
|
|
7n7d
|
DNA |
NMR |
Dickerhoff J, Brundridge N, McLuckey SA, Yang D |
(2021) "Berberine
Molecular Recognition of the Parallel MYC G-Quadruplex
in Solution." J.Med.Chem.,
64, 16205-16212. doi: 10.1021/acs.jmedchem.1c01508.
|
Solution structure of the myc promoter g-quadruplex in
complex with berberine: conformer a . ➥ 3
G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0,
3(-P-P-P)
|
|
7n7e
|
DNA |
NMR |
Dickerhoff J, Brundridge N, McLuckey SA, Yang D |
(2021) "Berberine
Molecular Recognition of the Parallel MYC G-Quadruplex
in Solution." J.Med.Chem.,
64, 16205-16212. doi: 10.1021/acs.jmedchem.1c01508.
|
Solution structure of the myc promoter g-quadruplex in
complex with berberine: conformer b . ➥ 3
G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0,
3(-P-P-P)
|
|
7ntu
|
hydrolase |
X-ray (3.1 Å) |
Troisi R, Balasco N, Santamaria A, Vitagliano L, Sica
F |
(2021) "Structural
and functional analysis of the simultaneous binding of
two duplex/quadruplex aptamers to human
alpha-thrombin." Int.J.Biol.Macromol.,
181, 858-867. doi: 10.1016/j.ijbiomac.2021.04.076.
|
X-ray structure of the complex between human alpha
thrombin and two duplex-quadruplex aptamers: nu172 and
hd22_27mer . ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
|
|
7nwd
|
DNA |
NMR |
Peterkova K, Durnik I, Marek R, Plavec J, Podbevsek
P |
(2021) "c-kit2
G-quadruplex stabilized via a covalent probe: exploring
G-quartet asymmetry." Nucleic Acids Res.,
49, 8947-8960. doi: 10.1093/nar/gkab659.
|
Three-quartet c-kit2 g-quadruplex stabilized by a
pyrene conjugate . ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
7o1h
|
DNA |
NMR |
Mohr S, Jana J, Vianney YM, Weisz K |
(2021) "Expanding
the Topological Landscape by a G-Column Flip of a
Parallel G-Quadruplex." Chemistry,
27, 10437-10447. doi: 10.1002/chem.202101181.
|
Hybrid-2r quadruplex-duplex with (-p-p-l) topology and
3 syn residues . ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUD, hybrid2, 3+1, 3(-P-P-Lw)
|
|
7oa3
|
RNA |
X-ray (2.8 Å) |
Mieczkowski M, Steinmetzger C, Bessi I, Lenz AK,
Schmiedel A, Holzapfel M, Lambert C, Pena V, Hobartner
C |
(2021) "Large
Stokes shift fluorescence activation in an RNA aptamer
by intermolecular proton transfer to guanine."
Nat Commun, 12, 3549. doi:
10.1038/s41467-021-23932-0.
|
Crystal structure of chili RNA aptamer in complex with
dmhbo+ (iridium hexammine co-crystallized form) .
➥ 2 G-tetrads, 1 G4 helix
|
|
7oar
|
hydrolase |
X-ray (2.58 Å) |
Dai YX, Guo HL, Liu NN, Chen WF, Ai X, Li HH, Sun B,
Hou XM, Rety S, Xi XG |
(2022) "Structural
mechanism underpinning Thermus oshimai Pif1-mediated
G-quadruplex unfolding." Embo Rep.,
23, e53874. doi: 10.15252/embr.202153874.
|
Crystal structure of helicase pif1 from thermus oshimai
in complex with parallel g-quadruplex . ➥ 3
G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0,
3(-P-P-P)
|
|
7oav
|
RNA |
X-ray (2.99 Å) |
Mieczkowski M, Steinmetzger C, Bessi I, Lenz AK,
Schmiedel A, Holzapfel M, Lambert C, Pena V, Hobartner
C |
(2021) "Large
Stokes shift fluorescence activation in an RNA aptamer
by intermolecular proton transfer to guanine."
Nat Commun, 12, 3549. doi:
10.1038/s41467-021-23932-0.
|
Crystal structure of chili RNA aptamer in complex with
dmhbo+ (iridium iii hexammine soaking crystal form) .
➥ 8 G-tetrads, 4 G4 helices
|
|
7oaw
|
RNA |
X-ray (2.95 Å) |
Mieczkowski M, Steinmetzger C, Bessi I, Lenz AK,
Schmiedel A, Holzapfel M, Lambert C, Pena V, Hobartner
C |
(2021) "Large
Stokes shift fluorescence activation in an RNA aptamer
by intermolecular proton transfer to guanine."
Nat Commun, 12, 3549. doi:
10.1038/s41467-021-23932-0.
|
Crystal structure of the chili RNA aptamer in complex
with dmhbi+ . ➥ 8 G-tetrads, 4 G4 helices
|
|
7oax
|
RNA |
X-ray (2.24 Å) |
Mieczkowski M, Steinmetzger C, Bessi I, Lenz AK,
Schmiedel A, Holzapfel M, Lambert C, Pena V, Hobartner
C |
(2021) "Large
Stokes shift fluorescence activation in an RNA aptamer
by intermolecular proton transfer to guanine."
Nat Commun, 12, 3549. doi:
10.1038/s41467-021-23932-0.
|
Crystal structure of the chili RNA aptamer in complex
with dmhbo+ . ➥ 8 G-tetrads, 4 G4 helices
|
|
7oqt
|
DNA |
NMR |
Marquevielle J, De Rache A, Vialet B, Morvan E,
Mergny JL, Amrane S |
(2022) "G-quadruplex
structure of the C. elegans telomeric repeat: a two
tetrads basket type conformation stabilized by a
non-canonical C-T base-pair." Nucleic Acids
Res., 50, 7134-7146. doi:
10.1093/nar/gkac523.
|
G-quadruplex structure of the c. elegans telomeric
repeat: a two tetrads basket type conformation
stabilised by a hoogsteen c-t base-pair . ➥ 2
G-tetrads, 1 G4 helix, 1 G4 stem, UDDU,
anti-parallel:basket, 2+2, 2(-LwD+Ln)
|
|
7otb
|
DNA |
X-ray (1.6 Å) |
McQuaid KT, Takahashi S, Baumgaertner L, Cardin DJ,
Paterson NG, Hall JP, Sugimoto N, Cardin CJ |
(2022) "Ruthenium
Polypyridyl Complex Bound to a Unimolecular Chair-Form
G-Quadruplex." J.Am.Chem.Soc.,
144, 5956-5964. doi: 10.1021/jacs.2c00178.
|
Ruthenium polypridyl complex bound to a unimolecular
chair-form g-quadruplex . ➥
3 G-tetrads, 1 G4 helix,
1 G4 stem, UDUD, anti-parallel:chair, 2+2,
3(-Lw-Ln-Lw)
|
|
7pne
|
DNA |
NMR |
Vianney YM, Weisz K |
(2022) "Indoloquinoline
Ligands Favor Intercalation at Quadruplex-Duplex
Interfaces." Chemistry,
28, e202103718. doi: 10.1002/chem.202103718.
|
Parallel q-d hybrid with 3' duplex stem-loop as a
lateral snapback loop . ➥
3 G-tetrads, 1 G4 helix,
1 G4 stem, UUUU, parallel, 4+0, 2(-P-P-P)
|
|
7png
|
DNA |
NMR |
Vianney YM, Weisz K |
(2022) "Indoloquinoline
Ligands Favor Intercalation at Quadruplex-Duplex
Interfaces." Chemistry,
28, e202103718. doi: 10.1002/chem.202103718.
|
Solution structure of 1:1 complex of an indoloquinoline
derivative syuiq-5 to parallel quadruplex-duplex (q-d)
hybrid . ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 2(-P-P-P)
|
|
7pnl
|
DNA |
X-ray (1.83 Å) |
Nocentini A, Di Porzio A, Bonardi A, Bazzicalupi C,
Petreni A, Biver T, Bua S, Marzano S, Amato J, Pagano B,
Iaccarino N, De Tito S, Amente S, Supuran CT, Randazzo A,
Gratteri P |
(2024) "Development
of a multi-targeted chemotherapeutic approach based on
G-quadruplex stabilisation and carbonic anhydrase
inhibition." J Enzyme Inhib Med Chem,
39, 2366236. doi: 10.1080/14756366.2024.2366236.
|
Complex between monomolecular human telomeric
g-quadruplex and a sulfonamide derivative of the
natural alkaloid berberine . ➥
3 G-tetrads, 1 G4 helix,
1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
7ps8
|
virus |
NMR |
Marquevielle J, Amrane S |
"NMR Structure of the U3 RNA G-quadruplex." |
NMR structure of the u3 RNA g-quadruplex . ➥ 3
G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0,
3(-P-P-P)
|
|
7q48
|
RNA |
NMR |
Wang Z, Jurt S, Dominguez-Martin A, Johannsen S,
Sigel RKO |
"Solution structure of an intramolecular RNA
G-quadruplex formed by the 6A8U17U mutant from a 22mer
guanine-rich sequence within the 5'UTR of BCL-2 proto
onco-gene." |
Solution structure of an intramolecular RNA
g-quadruplex formed by the 6a8u17u mutant from a 22mer
guanine-rich sequence within the 5'utr of bcl-2 proto
onco-gene . ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
7q6l
|
RNA |
NMR |
Wang Z, Jurt S, Dominguez-Martin A, Johannsen S,
Sigel RKO |
"Solution structure of an intramolecular RNA
G-quadruplex formed by the 6A8A17U mutant from a 22mer
guanine-rich sequence within the 5'UTR of BCL-2
proto-oncogene." |
Solution structure of an intramolecular RNA
g-quadruplex formed by the 6a8a17u mutant from a 22mer
guanine-rich sequence within the 5'utr of bcl-2
proto-oncogene . ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
7qa2
|
RNA |
NMR |
Wang Z, Falk T, Jurt S, Johannsen S, Sigel RKO |
"Solution structure of an intramolecular RNA
G-quadruplex formed by the 6A mutant from a 22mer
guanine-rich sequence within the 5'UTR of BCL-2
proto-oncogene." |
Solution structure of an intramolecular RNA
g-quadruplex formed by the 6a mutant from a 22mer
guanine-rich sequence within the 5'utr of bcl-2
proto-oncogene . ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
7qvq
|
DNA |
X-ray (2.4 Å) |
Bazzicalupi C, Bonardi A, Biver T, Ferraroni M, Papi
F, Savastano M, Lombardi P, Gratteri P |
(2022) "Probing
the Efficiency of 13-Pyridylalkyl Berberine Derivatives
to Human Telomeric G-Quadruplexes Binding:
Spectroscopic, Solid State and In Silico Analysis."
Int J Mol Sci, 23. doi:
10.3390/ijms232214061.
|
Human telomeric DNA g-quadruplex of a gold(iii) complex
containing the 2,4,6-tris (2-pyrimidyl)-1,3,5-triazine
ligand . ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
7sxp
|
RNA |
X-ray (2.9 Å) |
Balaratnam S, Torrey ZR, Calabrese DR, Banco MT,
Yazdani K, Liang X, Fullenkamp CR, Seshadri S, Holewinski
RJ, Andresson T, Ferre-D'Amare AR, Incarnato D,
Schneekloth Jr JS |
(2023) "Investigating
the NRAS 5' UTR as a target for small molecules."
Cell Chem Biol, 30,
643-657.e8. doi: 10.1016/j.chembiol.2023.05.004.
|
G-quadruplex structure formed in the nras mrna with a
g8u substitution . ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 3(-P-P)
|
|
7v3t
|
DNA |
NMR |
Zhu BC, He J, Xia XY, Jiang J, Liu W, Liu LY, Liang
BB, Yao HG, Ke Z, Xia W, Mao ZW |
(2022) "Solution
structure of a thrombin binding aptamer complex with a
non-planar platinum(ii) compound." Chem
Sci, 13, 8371-8379. doi: 10.1039/d2sc01196d.
|
Solution structure of thrombin binding aptamer
g-quadruplex bound a self-adaptive small molecule with
rotated ligands . ➥ 2 G-tetrads, 1 G4 helix, 1 G4
stem, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
|
|
7v6v
|
DNA |
NMR |
Hu W, Jing H, Fu W, Wang Z, Zhou J, Zhang N |
(2023) "Conversion
to Trimolecular G-Quadruplex by Spontaneous Hoogsteen
Pairing-Based Strand Displacement Reaction between
Bimolecular G-Quadruplex and Double G-Rich Probes."
J.Am.Chem.Soc. doi: 10.1021/jacs.3c05617.
|
Trimolecular g-quadruplexes consists of a hairpin motif
and two short chains . ➥
3 G-tetrads, 1 G4 helix,
1 G4 stem, UUUU, parallel, 4+0
|
|
7vf1
|
DNA |
NMR |
Maity A, Lim KW, Shneider NA, Chen G, Phan AT |
"A duplex-quadruplex hybrid formed by d[G4C2]
repeats." |
Solution structure of a duplex-quadruplex hybrid formed
by d[g4c2] repeats . ➥
2 G-tetrads, 1 G4 helix,
1 G4 stem, UUDD, anti-parallel:basket2, 2+2
|
|
7w0x
|
DNA |
NMR |
Zhang N, Jing HT, Fu WQ |
"NMR structure of an alternating antiparallel
tetrameric G-quadruplex assembled by the single-repeat of
human telomeric DNA d(GGGTTA)." |
Tetrameric antiparallel g-quadruplex formed by natural
human telomeric sequence . ➥
3 G-tetrads, 1 G4 helix,
1 G4 stem, UDUD, anti-parallel:chair, 2+2
|
|
7w9n
|
DNA |
NMR |
Xu G, Zhao J, Yu H, Wang C, Huang Y, Zhao Q, Zhou X,
Li C, Liu M |
(2022) "Structural
Insights into the Mechanism of High-Affinity Binding of
Ochratoxin A by a DNA Aptamer."
J.Am.Chem.Soc., 144,
7731-7740. doi: 10.1021/jacs.2c00478.
|
The structure of oba33-ota complex . ➥ 2
G-tetrads, 1 G4 helix, 1 G4 stem, UDUD,
anti-parallel:chair, 2+2, 2(-Lw-Ln-Lw)
|
|
7wgw
|
DNA |
NMR |
Wang KB, Liu Y, Li Y, Dickerhoff J, Li J, Yang MH,
Yang D, Kong LY |
(2022) "Oxidative
Damage Induces a Vacancy G-Quadruplex That Binds
Guanine Metabolites: Solution Structure of a cGMP
Fill-in Vacancy G-Quadruplex in the Oxidized BLM Gene
Promoter." J.Am.Chem.Soc.,
144, 6361-6372. doi: 10.1021/jacs.2c00435.
|
NMR solution structure of a cgmp fill-in vacancy
g-quadruplex formed in the oxidized blm gene promoter .
➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 2(-P-P-P)
|
|
7x2z
|
DNA |
NMR |
Liu L-Y, Ma TZ, Zeng YL, Liu W, Mao Z-W |
(2022) "Structural
Basis of Pyridostatin and Its Derivatives Specifically
Binding to G-Quadruplexes."
J.Am.Chem.Soc., 144,
11878-11887. doi: 10.1021/jacs.2c04775.
|
NMR solution structure of the 1:1 complex of a
pyridostatin derivative (pypds) bound to a g-quadruplex
myt1l . ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UDUU, hybrid3, 3+1, 3(-Lw-Ln-P)
|
|
7x3a
|
DNA |
NMR |
Liu L-Y, Ma TZ, Zeng YL, Liu W, Mao Z-W |
(2022) "Structural
Basis of Pyridostatin and Its Derivatives Specifically
Binding to G-Quadruplexes."
J.Am.Chem.Soc., 144,
11878-11887. doi: 10.1021/jacs.2c04775.
|
NMR solution structure of the 1:1 complex of a
pyridostatin (pds) bound to a g-quadruplex myt1l .
➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UDUU, hybrid3, 3+1, 3(-Lw-Ln-P)
|
|
7x7g
|
DNA |
X-ray (2.19 Å) |
Ngo KH, Liew CW, Lattmann S, Winnerdy FR, Phan
AT |
(2022) "Crystal
structures of an HIV-1 integrase aptamer: Formation of
a water-mediated A.G.G.G.G pentad in an interlocked
G-quadruplex."
Biochem.Biophys.Res.Commun.,
613, 153-158. doi: 10.1016/j.bbrc.2022.04.020.
|
Crystal structure of a dimeric interlocked parallel
g-quadruplex . ➥ 6 G-tetrads, 1 G4 helix, 2 G4
stems, 1 G4 coaxial stack, UUUU, parallel, 4+0,
2(-P-P-P), coaxial interfaces: 5'/5'-SEPARATED
|
|
7x8m
|
DNA |
NMR |
Wang KB, Liu Y, Li J, Xiao C, Wang Y, Gu W, Li Y, Xia
YZ, Yan T, Yang MH, Kong LY |
(2022) "Structural
insight into the bulge-containing KRAS oncogene
promoter G-quadruplex bound to berberine and
coptisine." Nat Commun,
13, 6016. doi: 10.1038/s41467-022-33761-4.
|
NMR solution structure of the 2:1 berberine-kras-g4
complex . ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
7x8n
|
DNA |
NMR |
Wang KB, Liu Y, Li J, Xiao C, Wang Y, Gu W, Li Y, Xia
YZ, Yan T, Yang MH, Kong LY |
(2022) "Structural
insight into the bulge-containing KRAS oncogene
promoter G-quadruplex bound to berberine and
coptisine." Nat Commun,
13, 6016. doi: 10.1038/s41467-022-33761-4.
|
NMR solution structure of the wild-type
bulge-containing kras-g4 . ➥
3 G-tetrads, 1 G4 helix,
1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
7x8o
|
DNA |
NMR |
Wang KB, Liu Y, Li J, Xiao C, Wang Y, Gu W, Li Y, Xia
YZ, Yan T, Yang MH, Kong LY |
(2022) "Structural
insight into the bulge-containing KRAS oncogene
promoter G-quadruplex bound to berberine and
coptisine." Nat Commun,
13, 6016. doi: 10.1038/s41467-022-33761-4.
|
NMR solution structure of the 2:1 coptisine-kras-g4
complex . ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
7xdh
|
DNA |
X-ray (1.83 Å) |
Ngo KH, Liew CW, Lattmann S, Winnerdy FR, Phan
AT |
(2022) "Crystal
structures of an HIV-1 integrase aptamer: Formation of
a water-mediated A.G.G.G.G pentad in an interlocked
G-quadruplex."
Biochem.Biophys.Res.Commun.,
613, 153-158. doi: 10.1016/j.bbrc.2022.04.020.
|
Crystal structure of a dimeric interlocked parallel
g-quadruplex . ➥ 6 G-tetrads, 1 G4 helix, 2 G4
stems, 1 G4 coaxial stack, UUUU, parallel, 4+0,
2(-P-P-P), coaxial interfaces: 5'/5'-SEPARATED
|
|
7xfv
|
DNA |
NMR |
Zhang Y, Lan W, Wang C, Xue H, Cao C |
(2023) "Dimeric G-quadruplex DNA Structure in the
Proximal Promoter of VEGFR-2 Reveals a New Drug Target
to Inhibit Tumor Angiogenesis." Chin.J.Chem.,
40, 2179-2187. doi: 10.1002/cjoc.202200260.
|
Dimeric g-quadruplex DNA formed in the proximal
promoter of vegfr-2 . ➥
4 G-tetrads, 1 G4 helix,
1 G4 stem, UUUU, parallel, 4+0
|
|
7xh9
|
DNA |
X-ray (1.63 Å) |
Ngo KH, Liew CW, Lattmann S, Winnerdy FR, Phan
AT |
(2022) "Crystal
structures of an HIV-1 integrase aptamer: Formation of
a water-mediated A.G.G.G.G pentad in an interlocked
G-quadruplex."
Biochem.Biophys.Res.Commun.,
613, 153-158. doi: 10.1016/j.bbrc.2022.04.020.
|
Crystal structure of a dimeric interlocked parallel
g-quadruplex . ➥ 6 G-tetrads, 1 G4 helix, 2 G4
stems, 1 G4 coaxial stack, UUUU, parallel, 4+0,
2(-P-P-P), coaxial interfaces: 5'/5'-SEPARATED
|
|
7xhd
|
DNA |
X-ray (1.66 Å) |
Ngo KH, Liew CW, Lattmann S, Winnerdy FR, Phan
AT |
(2022) "Crystal
structures of an HIV-1 integrase aptamer: Formation of
a water-mediated A•G•G•G•G pentad in an interlocked
G-quadruplex."
Biochem.Biophys.Res.Commun.,
613, 153-158. doi: 10.1016/j.bbrc.2022.04.020.
|
Crystal structure of a dimeric interlocked parallel
g-quadruplex . ➥ 6 G-tetrads, 1 G4 helix, 2 G4
stems, 1 G4 coaxial stack, UUUU, parallel, 4+0,
2(-P-P-P), coaxial interfaces: 5'/5'-SEPARATED
|
|
7xie
|
DNA |
X-ray (1.97 Å) |
Ngo KH, Liew CW, Lattmann S, Winnerdy FR, Phan
AT |
(2022) "Crystal
structures of an HIV-1 integrase aptamer: Formation of
a water-mediated A•G•G•G•G pentad in an interlocked
G-quadruplex."
Biochem.Biophys.Res.Commun.,
613, 153-158. doi: 10.1016/j.bbrc.2022.04.020.
|
Crystal structure of a dimeric interlocked parallel
g-quadruplex . ➥ 6 G-tetrads, 1 G4 helix, 2 G4
stems, 1 G4 coaxial stack, UUUU, parallel, 4+0,
2(-P-P-P), coaxial interfaces: 5'/5'-SEPARATED
|
|
7ys5
|
DNA |
NMR |
Yin S, Cao C |
"RET G-quadruplex in 10mM Na+." |
Ret g-quadruplex in 10mm na+ . ➥ 3
G-tetrads, 1 G4 helix, 1 G4 stem, UDDD, hybrid4, 1+3,
2(D+PX)
|
|
7ys7
|
DNA |
NMR |
Yin S, Cao C |
"RET oncogene primer G-quadruplex in Na+." |
Ret oncogene primer g4-DNA in 100mmna+ . ➥ 3
G-tetrads, 1 G4 helix, 1 G4 stem, UDDD, hybrid4, 1+3,
2(D+PX)
|
|
7z9l
|
DNA |
NMR |
Ghosh A, Trajkovski M, Teulade-Fichou MP, Gabelica V,
Plavec J |
(2022) "Phen-DC
3 Induces Refolding of Human Telomeric DNA into a
Chair-Type Antiparallel G-Quadruplex through Ligand
Intercalation." Angew.Chem.Int.Ed.Engl.,
61, e202207384. doi: 10.1002/anie.202207384.
|
Phen-dc3 intercalation causes hybrid-to-antiparallel
transformation of human telomeric DNA g-quadruplex .
➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UDUD, anti-parallel:chair, 2+2, 3(+Ln+Lw+Ln)
|
|
7zek
|
DNA |
NMR |
Jana J, Vianney YM, Schroder N, Weisz K |
(2022) "Guiding
the folding of G-quadruplexes through loop residue
interactions." Nucleic Acids Res.,
50, 7161-7175. doi: 10.1093/nar/gkac549.
|
Structure of a hybrid-type g-quadruplex with a snapback
loop (hybrid 1r') . ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UDDD, hybrid4, 1+3, 2(+Ln+P+P)
|
|
7zem
|
DNA |
NMR |
Jana J, Vianney YM, Schroder N, Weisz K |
(2022) "Guiding
the folding of G-quadruplexes through loop residue
interactions." Nucleic Acids Res.,
50, 7161-7175. doi: 10.1093/nar/gkac549.
|
Structure of a parallel g-quadruplex with a snapback
loop . ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 2(-P-P-P)
|
|
7zeo
|
DNA |
NMR |
Jana J, Vianney YM, Schroder N, Weisz K |
(2022) "Guiding
the folding of G-quadruplexes through loop residue
interactions." Nucleic Acids Res.,
50, 7161-7175. doi: 10.1093/nar/gkac549.
|
Structure of a hybrid-type g-quadruplex with a snapback
loop and an all-syn g-column (hybrid-1r) . ➥ 3
G-tetrads, 1 G4 helix, 1 G4 stem, UDDD, hybrid4, 1+3,
2(+Ln+P+P)
|
|
7zj4
|
RNA |
cryo-EM (4.43 Å) |
McRae EKS, Vallina NS, Hansen BK, Boussebayle A,
Andersen ES |
"Structure determination of Pepper-Broccoli FRET pair
by RNA origami scaffolding." |
Ligand bound state of a brocolli-pepper aptamer fret
tile . ➥ 2 G-tetrads, 1 G4 helix, 1 G4
stem, UUDD, anti-parallel:basket2, 2+2, 2(-PD+P)
|
|
7zj5
|
RNA |
cryo-EM (4.55 Å) |
McRae EKS, Vallina NS, Hansen BK, Boussebayle A,
Andersen ES |
"Structure determination of Pepper-Broccoli FRET pair
by RNA origami scaffolding." |
Unbound state of a brocolli-pepper aptamer fret tile. .
➥ 2 G-tetrads, 1 G4 helix, 1 G4
stem, UUDD, anti-parallel:basket2, 2+2, 2(-PD+P)
|
|
7zkl
|
hydrolase |
X-ray (3.18 Å) |
Troisi R, Riccardi C, Perez de Carvasal K, Smietana
M, Morvan F, Del Vecchio P, Montesarchio D, Sica F |
(2022) "A
terminal functionalization strategy reveals unusual
binding abilities of anti-thrombin anticoagulant
aptamers." Mol Ther Nucleic Acids,
30, 585-594. doi: 10.1016/j.omtn.2022.11.007.
|
X-ray structure of the complex between human alpha
thrombin and a pseudo-cyclic thrombin binding aptamer
(tba-nnp-ddp) - crystal form alpha . ➥ 2
G-tetrads, 1 G4 helix, 1 G4 stem, UDUD,
anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
|
|
7zkm
|
hydrolase |
X-ray (2.0 Å) |
Troisi R, Riccardi C, Perez de Carvasal K, Smietana
M, Morvan F, Del Vecchio P, Montesarchio D, Sica F |
(2022) "A
terminal functionalization strategy reveals unusual
binding abilities of anti-thrombin anticoagulant
aptamers." Mol Ther Nucleic Acids,
30, 585-594. doi: 10.1016/j.omtn.2022.11.007.
|
X-ray structure of the complex between human alpha
thrombin and a pseudo-cyclic thrombin binding aptamer
(tba-nnp-ddp) - crystal form beta . ➥ 4
G-tetrads, 2 G4 helices, 2 G4 stems, UDUD,
anti-parallel:chair, 2+2, 2(+Ln+Ln); UDUD,
anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
|
|
7zkn
|
hydrolase |
X-ray (3.03 Å) |
Troisi R, Riccardi C, Perez de Carvasal K, Smietana
M, Morvan F, Del Vecchio P, Montesarchio D, Sica F |
(2022) "A
terminal functionalization strategy reveals unusual
binding abilities of anti-thrombin anticoagulant
aptamers." Mol Ther Nucleic Acids,
30, 585-594. doi: 10.1016/j.omtn.2022.11.007.
|
X-ray structure of the complex between human alpha
thrombin and a pseudo-cyclic thrombin binding aptamer
(tba-nnp-ddp) - crystal form gamma . ➥ 4
G-tetrads, 2 G4 helices, 2 G4 stems, UDUD,
anti-parallel:chair, 2+2, 2(+Ln+Ln); UDUD,
anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
|
|
7zko
|
hydrolase |
X-ray (2.5 Å) |
Troisi R, Riccardi C, Perez de Carvasal K, Smietana
M, Morvan F, Del Vecchio P, Montesarchio D, Sica F |
(2022) "A
terminal functionalization strategy reveals unusual
binding abilities of anti-thrombin anticoagulant
aptamers." Mol Ther Nucleic Acids,
30, 585-594. doi: 10.1016/j.omtn.2022.11.007.
|
X-ray structure of the complex between human alpha
thrombin and a pseudo-cyclic thrombin binding aptamer
(tba-nnp-ddp) - crystal form delta . ➥ 3
G-tetrads, 1 G4 helix, 1 G4 stem, UDUD,
anti-parallel:chair, 2+2, 2(+Ln+Ln)
|
|
7zqs
|
membrane protein |
cryo-EM (2.54 Å) |
Cheng EL, Cardle II, Kacherovsky N, Bansia H, Wang T,
Zhou Y, Raman J, Yen A, Gutierrez D, Salipante SJ, des
Georges A, Jensen MC, Pun SH |
(2022) "Discovery
of a Transferrin Receptor 1-Binding Aptamer and Its
Application in Cancer Cell Depletion for Adoptive
T-Cell Therapy Manufacturing."
J.Am.Chem.Soc., 144,
13851-13864. doi: 10.1021/jacs.2c05349.
|
cryo-EM structure of human transferrin receptor 1 bound
to DNA aptamer . ➥ 2 G-tetrads
|
|
7zur
|
DNA |
X-ray (1.6 Å) |
Bazzicalupi C, Bonardi A, Biver T, Ferraroni M, Papi
F, Savastano M, Lombardi P, Gratteri P |
(2022) "Probing
the Efficiency of 13-Pyridylalkyl Berberine Derivatives
to Human Telomeric G-Quadruplexes Binding:
Spectroscopic, Solid State and In Silico Analysis."
Int J Mol Sci, 23. doi:
10.3390/ijms232214061.
|
Four carbons pendant pyridine derivative of the natural
alkaloid berberine as human telomeric g-quadruplex
binder . ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0
|
|
8aad
|
DNA |
X-ray (2.04 Å) |
Bazzicalupi C, Bonardi A, Biver T, Ferraroni M, Papi
F, Savastano M, Lombardi P, Gratteri P |
(2022) "Probing
the Efficiency of 13-Pyridylalkyl Berberine Derivatives
to Human Telomeric G-Quadruplexes Binding:
Spectroscopic, Solid State and In Silico Analysis."
Int J Mol Sci, 23. doi:
10.3390/ijms232214061.
|
Two carbons pendant pyridine derivative of the natural
alkaloid berberine as human telomeric g-quadruplex
binder . ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0
|
|
8abd
|
DNA |
NMR |
Vianney YM, Weisz K |
(2022) "High-affinity
binding at quadruplex-duplex junctions: rather the rule
than the exception." Nucleic Acids Res.,
50, 11948-11964. doi: 10.1093/nar/gkac1088.
|
Solution structure of phen-dc3 intercalating into a
quadruplex-duplex hybrid . ➥
3 G-tetrads, 1 G4 helix,
1 G4 stem, UUUU, parallel, 4+0, 2(-P-P-P)
|
|
8abn
|
DNA |
NMR |
Vianney YM, Weisz K |
(2022) "High-affinity
binding at quadruplex-duplex junctions: rather the rule
than the exception." Nucleic Acids Res.,
50, 11948-11964. doi: 10.1093/nar/gkac1088.
|
Solution structure of a phenyl-indoloquinoline
intercalating into a quadruplex-duplex hybrid .
➥ 2 G-tetrads, 1 G4 helix, 1 G4
stem, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
|
|
8bw5
|
hydrolase |
X-ray (2.8 Å) |
Troisi R, Napolitano V, Rossitto E, Osman W, Nagano
M, Wakui K, Popowicz GM, Yoshimoto K, Sica F |
(2023) "Steric
hindrance and structural flexibility shape the
functional properties of a guanine-rich
oligonucleotide." Nucleic Acids Res.,
51, 8880-8890. doi: 10.1093/nar/gkad634.
|
X-ray structure of the complex between human alpha
thrombin and the duplex-quadruplex aptamer m08s-1_41mer
. ➥ 2 G-tetrads, 1 G4 helix, 1 G4
stem, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
|
|
8bzu
|
DNA |
NMR |
Gajarsky M, Stadlbauer P, Sponer J, Cucchiarini A,
Dobrovolna M, Brazda V, Mergny JL, Trantirek L, Lenarcic
Zivkovic M |
(2024) "DNA
Quadruplex Structure with a Unique Cation
Dependency." Angew.Chem.Int.Ed.Engl.,
63, e202313226. doi: 10.1002/anie.202313226.
|
Double-ion dependent DNA quadruplex structure formed by
c.elegans telomeric sequence . ➥ 1
G-tetrad
|
|
8c7a
|
DNA |
NMR |
Zalar M, Wang B, Plavec J, Sket P |
(2023) "Insight
into Tetramolecular DNA G-Quadruplexes Associated with
ALS and FTLD: Cation Interactions and Formation of
Higher-Ordered Structure." Int J Mol Sci,
24. doi: 10.3390/ijms241713437.
|
Slow cation movements within tetramolecular
g-quadruplex: vacant cation binding sites in addition
to all syn g-quartet . ➥
4 G-tetrads, 1 G4 helix,
1 G4 stem, UUUU, parallel, 4+0
|
|
8c7b
|
DNA |
NMR |
Zalar M, Wang B, Plavec J, Sket P |
(2023) "Insight
into Tetramolecular DNA G-Quadruplexes Associated with
ALS and FTLD: Cation Interactions and Formation of
Higher-Ordered Structure." Int J Mol Sci,
24. doi: 10.3390/ijms241713437.
|
Slow cation movements within tetramolecular
g-quadruplex: vacant cation binding sites in addition
to all syn g-quartet . ➥
4 G-tetrads, 1 G4 helix,
1 G4 stem, UUUU, parallel, 4+0
|
|
8d78
|
DNA |
X-ray (2.12 Å) |
Beseiso D, Chen EV, Yatsunyk LA |
"Biophysical and structural characterization of
telomeric G-quadruplexes from Tetrahymena thermophila in
complex with N-Methyl Mesoporphyrin IX." |
Crystal structure of a ba stabilized four-tetrad,
parallel tetrahymena thermophila telomeric g-quadruplex
in complex with n-methyl mesoporphyrin ix .
➥ 4 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 4(-P-P-P)
|
|
8d79
|
DNA |
X-ray (1.99 Å) |
Beseiso D, Chen EV, Yatsunyk LA |
"Biophysical and structural characterization of
telomeric G-quadruplexes from Tetrahymena thermophila in
complex with N-Methyl Mesoporphyrin IX." |
Crystal structure of a four-tetrad, parallel, and na+
stabilized tetrahymena thermophila telomeric
g-quadruplex in complex with n-methyl mesoporphyrin ix
. ➥ 4 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 4(-P-P-P)
|
|
8dut
|
DNA |
cryo-EM (7.4 Å) |
Monsen RC, Chua EYD, Hopkins JB, Chaires JB, Trent
JO |
(2023) "Structure
of a 28.5 kDa duplex-embedded G-quadruplex system
resolved to 7.4 angstrom resolution with cryo-EM."
Nucleic Acids Res., 51,
1943-1959. doi: 10.1093/nar/gkad014.
|
Duplex-g-quadruplex-duplex (dgd) class_1 . ➥ 3
G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0,
3(-P-P-P)
|
|
8ebo
|
DNA |
X-ray (1.98 Å) |
Ye M, Chen EV, Pfeil SH, Martin KN, Atrafi T, Yun S,
Martinez Z, Yatsunyk LA |
(2022) "Homopurine
guanine-rich sequences in complex with N-methyl
mesoporphyrin IX form parallel G-quadruplex dimers and
display a unique symmetry tetrad."
Bioorg.Med.Chem., 77, 117112.
doi: 10.1016/j.bmc.2022.117112.
|
Homopurine parallel g-quadruplex from human chromosome
7 stabilized by k+ ions . ➥
3 G-tetrads, 1 G4 helix,
1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
8edp
|
DNA |
X-ray (2.01 Å) |
Ye M, Chen EV, Pfeil SH, Martin KN, Atrafi T, Yun S,
Martinez Z, Yatsunyk LA |
(2022) "Homopurine
guanine-rich sequences in complex with N-methyl
mesoporphyrin IX form parallel G-quadruplex dimers and
display a unique symmetry tetrad."
Bioorg.Med.Chem., 77, 117112.
doi: 10.1016/j.bmc.2022.117112.
|
Crystal structure of a three-tetrad, parallel, and k+
stabilized homopurine g-quadruplex from human
chromosome 7 . ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
8eyu
|
RNA |
X-ray (1.95 Å) |
Passalacqua LFM, Starich MR, Link KA, Wu J, Knutson
JR, Tjandra N, Jaffrey SR, Ferre-D'Amare AR |
(2023) "Co-crystal
structures of the fluorogenic aptamer Beetroot show
that close homology may not predict similar RNA
architecture." Nat Commun,
14, 2969. doi: 10.1038/s41467-023-38683-3.
|
Structure of beetroot dimer bound to dfame .
➥ 6 G-tetrads, 1 G4 helix, 2 G4
stems, 1 G4 coaxial stack, UUUU, parallel, 4+0,
2(-P-P-P), coaxial interfaces: 5'/5'
|
|
8eyv
|
RNA |
X-ray (2.55 Å) |
Passalacqua LFM, Starich MR, Link KA, Wu J, Knutson
JR, Tjandra N, Jaffrey SR, Ferre-D'Amare AR |
(2023) "Co-crystal
structures of the fluorogenic aptamer Beetroot show
that close homology may not predict similar RNA
architecture." Nat Commun,
14, 2969. doi: 10.1038/s41467-023-38683-3.
|
Structure of beetroot dimer bound to dfho .
➥ 6 G-tetrads, 1 G4 helix, 2 G4
stems, 1 G4 coaxial stack, UUUU, parallel, 4+0,
2(-P-P-P), coaxial interfaces: 5'/5'
|
|
8eyw
|
RNA |
X-ray (2.1 Å) |
Passalacqua LFM, Starich MR, Link KA, Wu J, Knutson
JR, Tjandra N, Jaffrey SR, Ferre-D'Amare AR |
(2023) "Co-crystal
structures of the fluorogenic aptamer Beetroot show
that close homology may not predict similar RNA
architecture." Nat Commun,
14, 2969. doi: 10.1038/s41467-023-38683-3.
|
Beetroot dimer bound to tht . ➥ 6
G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack,
UUUU, parallel, 4+0, 2(-P-P-P), coaxial interfaces:
5'/5'
|
|
8f0n
|
RNA |
X-ray (2.85 Å) |
Passalacqua LFM, Starich MR, Link KA, Wu J, Knutson
JR, Tjandra N, Jaffrey SR, Ferre-D'Amare AR |
(2023) "Co-crystal
structures of the fluorogenic aptamer Beetroot show
that close homology may not predict similar RNA
architecture." Nat Commun,
14, 2969. doi: 10.1038/s41467-023-38683-3.
|
Wobble beetroot (a16u-u38g) dimer bound to dfho .
➥ 6 G-tetrads, 1 G4 helix, 2 G4
stems, 1 G4 coaxial stack, UUUU, parallel, 4+0,
2(-P-P-P), coaxial interfaces: 5'/5'
|
|
8fhv
|
DNA |
X-ray (2.5 Å) |
Passalacqua LFM, Banco MT, Moon JD, Li X, Jaffrey SR,
Ferre-D'Amare AR |
(2023) "Intricate
3D architecture of a DNA mimic of GFP."
Nature, 618, 1078-1084. doi:
10.1038/s41586-023-06229-8.
|
Structure of lettuce aptamer bound to dfhbi-1t with
thallium i ions . ➥ 2 G-tetrads, 1 G4 helix, 1 G4
stem, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
|
|
8fhx
|
DNA |
X-ray (2.5 Å) |
Passalacqua LFM, Banco MT, Moon JD, Li X, Jaffrey SR,
Ferre-D'Amare AR |
(2023) "Intricate
3D architecture of a DNA mimic of GFP."
Nature, 618, 1078-1084. doi:
10.1038/s41586-023-06229-8.
|
Structure of lettuce aptamer bound to dfhbi-1t .
➥ 2 G-tetrads, 1 G4 helix, 1 G4
stem, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
|
|
8fhz
|
DNA |
X-ray (2.6 Å) |
Passalacqua LFM, Banco MT, Moon JD, Li X, Jaffrey SR,
Ferre-D'Amare AR |
(2023) "Intricate
3D architecture of a DNA mimic of GFP."
Nature, 618, 1078-1084. doi:
10.1038/s41586-023-06229-8.
|
Structure of lettuce aptamer bound to dfho .
➥ 2 G-tetrads, 1 G4 helix, 1 G4
stem, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
|
|
8fi0
|
DNA |
X-ray (3.0 Å) |
Passalacqua LFM, Banco MT, Moon JD, Li X, Jaffrey SR,
Ferre-D'Amare AR |
(2023) "Intricate
3D architecture of a DNA mimic of GFP."
Nature, 618, 1078-1084. doi:
10.1038/s41586-023-06229-8.
|
Structure of lettuce aptamer bound to dfame .
➥ 2 G-tetrads, 1 G4 helix, 1 G4
stem, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
|
|
8fi1
|
DNA |
X-ray (2.6 Å) |
Passalacqua LFM, Banco MT, Moon JD, Li X, Jaffrey SR,
Ferre-D'Amare AR |
(2023) "Intricate
3D architecture of a DNA mimic of GFP."
Nature, 618, 1078-1084. doi:
10.1038/s41586-023-06229-8.
|
Structure of lettuce c20g bound to dfho . ➥ 2
G-tetrads, 1 G4 helix, 1 G4 stem, UDUD,
anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
|
|
8fi2
|
DNA |
X-ray (3.0 Å) |
Passalacqua LFM, Banco MT, Moon JD, Li X, Jaffrey SR,
Ferre-D'Amare AR |
(2023) "Intricate
3D architecture of a DNA mimic of GFP."
Nature, 618, 1078-1084. doi:
10.1038/s41586-023-06229-8.
|
Structure of lettuce c20t bound to dfhbi-1t .
➥ 2 G-tetrads, 1 G4 helix, 1 G4
stem, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
|
|
8fi7
|
DNA |
X-ray (2.9 Å) |
Passalacqua LFM, Banco MT, Moon JD, Li X, Jaffrey SR,
Ferre-D'Amare AR |
(2023) "Intricate
3D architecture of a DNA mimic of GFP."
Nature, 618, 1078-1084. doi:
10.1038/s41586-023-06229-8.
|
Structure of lettuce c20t bound to dfho . ➥ 2
G-tetrads, 1 G4 helix, 1 G4 stem, UDUD,
anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
|
|
8fi8
|
DNA |
X-ray (2.8 Å) |
Passalacqua LFM, Banco MT, Moon JD, Li X, Jaffrey SR,
Ferre-D'Amare AR |
(2023) "Intricate
3D architecture of a DNA mimic of GFP."
Nature, 618, 1078-1084. doi:
10.1038/s41586-023-06229-8.
|
Structure of lettuce c20t bound to dfame . ➥ 2
G-tetrads, 1 G4 helix, 1 G4 stem, UDUD,
anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
|
|
8fyh
|
gene regulation |
cryo-EM (3.4 Å) |
Song J, Gooding AR, Hemphill WO, Love BD, Robertson
A, Yao L, Zon LI, North TE, Kasinath V, Cech TR |
(2023) "Structural
basis for inactivation of PRC2 by G-quadruplex
RNA." Science, 381,
1331-1337. doi: 10.1126/science.adh0059.
|
G4 RNA-mediated prc2 dimer . ➥
3 G-tetrads, 1 G4 helix,
1 G4 stem, UUUU, parallel, 4+0,
|
|
8g2n
|
DNA |
X-ray (1.33 Å) |
Martin KN, Lam G, Reznichenko O, Brunner KE, Zdilla
MJ, McCarthy SE, Granzhan A, Yatsunyk LA |
(2025) "Conformational
Change in a Four-Tetrad DNA G-Quadruplex upon
Intercalation of a Small-Molecule Ligand PyDH2."
Angew.Chem.Int.Ed.Engl., 64,
e202501443. doi: 10.1002/anie.202501443.
|
Crystal structure of tetrahymena thermophila g-rich DNA
with novel ligand pydh2 . ➥
4 G-tetrads, 1 G4 helix,
1 G4 stem, UDUD, anti-parallel:chair, 2+2,
4(+Ln+Lw+Ln)
|
|
8gp7
|
DNA |
NMR |
Yin S, Lan W, Hou X, Liu Z, Xue H, Wang C, Tang GL,
Cao C |
(2023) "Trioxacarcin
A Interactions with G-Quadruplex DNA Reveal Its
Potential New Targets as an Anticancer Agent."
J.Med.Chem., 66, 6798-6810.
doi: 10.1021/acs.jmedchem.3c00178.
|
Structure of trioxacarcin a covalently bound to ret
g4-DNA . ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
8ht7
|
DNA binding protein |
NMR |
Geng Y, Liu C, Xu N, Shi X, Suen MC, Zhou B, Yan B,
Wu C, Li H, Song Y, Chen X, Wang Z, Cai Q, Zhu G |
(2024) "The
N-terminal region of Cdc6 specifically recognizes human
DNA G-quadruplex." Int.J.Biol.Macromol.,
260, 129487. doi: 10.1016/j.ijbiomac.2024.129487.
|
The n-terminal region of cdc6 specifically recognizes
human DNA g-quadruplex . ➥
3 G-tetrads, 1 G4 helix,
1 G4 stem, UDUD, anti-parallel:chair, 2+2,
3(+Ln+Lw+Ln)
|
|
8ijc
|
DNA |
NMR |
Liu LY, Ma TZ, Zeng YL, Liu W, Zhang H, Mao ZW |
(2023) "Organic-Platinum
Hybrids for Covalent Binding of G-Quadruplexes:
Structural Basis and Application to Cancer
Immunotherapy." Angew.Chem.Int.Ed.Engl.,
62, e202305645. doi: 10.1002/anie.202305645.
|
NMR solution structure of the 1:1 complex of a
platinum(ii) ligand l1-transpt covalently bound to a
g-quadruplex myt1l . ➥
3 G-tetrads, 1 G4 helix,
1 G4 stem, UDUU, hybrid3, 3+1, 3(-Lw-Ln-P)
|
|
8ipp
|
DNA binding protein-DNA |
X-ray (2.007 Å) |
Ngo KH, Liew CW, Heddi B, Phan AT |
(2024) "Structural
Basis for Parallel G-Quadruplex Recognition by an
Ankyrin Protein." J.Am.Chem.Soc.,
146, 13709-13713. doi: 10.1021/jacs.4c01971.
|
Crystal structure of the complex between an ankyrin and
a parallel g-quadruplex . ➥
2 G-tetrads, 1 G4 helix,
1 G4 stem, UUUU, parallel, 4+0, 2(-P-P-P)
|
|
8jfq
|
DNA |
NMR |
Liu Y, Li J, Zhang Y, Wang Y, Chen J, Bian Y, Xia Y,
Yang MH, Zheng K, Wang KB, Kong LY |
(2023) "Structure
of the Major G-Quadruplex in the Human EGFR Oncogene
Promoter Adopts a Unique Folding Topology with a
Distinctive Snap-Back Loop."
J.Am.Chem.Soc., 145,
16228-16237. doi: 10.1021/jacs.3c05214.
|
Structure of the major g-quadruplex in the human egfr
oncogene promoter adopts a unique folding topology with
a distinctive snap-back loop . ➥ 3
G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0,
2(-P-P-P)
|
|
8jic
|
DNA |
NMR |
Galer P, Wang B, Plavec J, Sket P |
(2023) "Unveiling
the structural mechanism of a G-quadruplex pH-Driven
switch." Biochimie, 214,
73-82. doi: 10.1016/j.biochi.2023.08.002.
|
Human telomere two-quartet g-quadruplex at ph 7.0 .
➥ 2 G-tetrads, 1 G4 helix, 1 G4
stem, UDDU, anti-parallel:basket, 2+2, 2(-LwD+Ln)
|
|
8jih
|
DNA |
NMR |
Galer P, Wang B, Plavec J, Sket P |
(2023) "Unveiling
the structural mechanism of a G-quadruplex pH-Driven
switch." Biochimie, 214,
73-82. doi: 10.1016/j.biochi.2023.08.002.
|
Human telomere two-quartet g-quadruplex at ph 5.0 .
➥ 2 G-tetrads, 1 G4 helix, 1 G4
stem, UUDD, anti-parallel:basket2, 2+2, 2(+LnD-Lw)
|
|
8k7w
|
RNA |
X-ray (2.24 Å) |
Ren Y, Lin X, Liao W, Peng X, Deng J, Zhang Z, Zhan
J, Zhou Y, Westhof E, Lilley DMJ, Wang J, Huang L |
(2025) "A
general strategy for engineering GU base pairs to
facilitate RNA crystallization." Nucleic Acids
Res., 53. doi: 10.1093/nar/gkae1218.
|
Crystal structure of broccoli aptamer with dfhbi-1t .
➥ 4 G-tetrads, 2 G4 helices, 2 G4
stems, UUDD, anti-parallel:basket2, 2+2, 2(-PD+P)
|
|
8k85
|
RNA |
X-ray (2.95 Å) |
Peng X, Huang L |
"Structural analysis of various Broccoli aptamers
with different Fluorophores." |
Crystal structure of red broccoli aptamer with obi .
➥ 4 G-tetrads, 2 G4 helices, 2 G4
stems, UUDD, anti-parallel:basket2, 2+2
|
|
8kf9
|
DNA |
NMR |
Zhang YP, Lan WX, Yin SW, Liu ZJ, Xue HJ, Cao CY |
"Stable G-quadruplex Conformation Formed in Promoter
Region of Oncogene RET Indicates New Target for
Anti-cancer Drug Screening." |
Stable g-quadruplex conformation formed in promoter
region of oncogene ret in 50 mm k+ solution .
➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UDDD, hybrid4, 1+3, 2(D+PX)
|
|
8kfl
|
DNA |
NMR |
Zhang YP, Lan WX, Yin SW, Liu ZJ, Xue HJ, Cao CY |
"Stable G-quadruplex Conformation Formed in Promoter
Region of Oncogene RET Indicates New Target for
Anti-cancer Drug Screening." |
Stable g-quadruplex conformation formed in promoter
region of oncogene ret in 100 mm na+ . ➥ 3
G-tetrads, 1 G4 helix, 1 G4 stem, UDDD, hybrid4, 1+3,
2(D+PX)
|
|
8p6b
|
DNA |
X-ray (2.5 Å) |
McQuaid KT, Cardin CJ |
"Ruthenium complex bound to an antiparallel
G-quadruplex." |
Ruthenium complex bound to a modified human telomeric
sequence giving an antiparallel g-quadruplex .
➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UDUD, anti-parallel:chair, 2+2, 3(+Lm+Ln+Lw)
|
|
8psb
|
DNA |
NMR |
Vianney YM, Schroder N, Jana J, Chojetzki G, Weisz
K |
(2023) "Showcasing
Different G-Quadruplex Folds of a G-Rich Sequence:
Between Rule-Based Prediction and Butterfly
Effect." J.Am.Chem.Soc.,
145, 22194-22205. doi: 10.1021/jacs.3c08336.
|
Three-layered parallel g-quadruplex with snapback loop
from a g-rich sequence with five g-runs . ➥ 3
G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0,
2(-P-P-P)
|
|
8psc
|
DNA |
NMR |
Vianney YM, Schroder N, Jana J, Chojetzki G, Weisz
K |
(2023) "Showcasing
Different G-Quadruplex Folds of a G-Rich Sequence:
Between Rule-Based Prediction and Butterfly
Effect." J.Am.Chem.Soc.,
145, 22194-22205. doi: 10.1021/jacs.3c08336.
|
Three-layered basket-type g-quadruplex from a g-rich
sequence with five g-runs . ➥
3 G-tetrads, 1 G4 helix,
1 G4 stem, UDDU, anti-parallel:basket, 2+2,
3(-LwD+Ln)
|
|
8pse
|
DNA |
NMR |
Vianney YM, Schroder N, Jana J, Chojetzki G, Weisz
K |
(2023) "Showcasing
Different G-Quadruplex Folds of a G-Rich Sequence:
Between Rule-Based Prediction and Butterfly
Effect." J.Am.Chem.Soc.,
145, 22194-22205. doi: 10.1021/jacs.3c08336.
|
(3+1) hybrid g-quadruplex from a g-rich sequence with
five g-runs . ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUD, hybrid2, 3+1, 3(-PD+Lw)
|
|
8psi
|
DNA |
NMR |
Vianney YM, Schroder N, Jana J, Chojetzki G, Weisz
K |
(2023) "Showcasing
Different G-Quadruplex Folds of a G-Rich Sequence:
Between Rule-Based Prediction and Butterfly
Effect." J.Am.Chem.Soc.,
145, 22194-22205. doi: 10.1021/jacs.3c08336.
|
G-quadruplex with a 1-nt v-shaped loop from a g-rich
sequence with five g-runs . ➥
3 G-tetrads, 1 G4 helix,
1 G4 stem, UDUD, anti-parallel:chair, 2+2,
2(-LwX+Lw)
|
|
8q4o
|
RNA |
NMR |
Orehova M, Plavec J, Kocman V |
(2024) "High-Resolution
Structure of RNA G-Quadruplex Containing Unique
Structural Motifs Originating from the 5'-UTR of Human
Tyrosine Kinase 2 (TYK2)." Acs Omega,
9, 7215-7229. doi: 10.1021/acsomega.3c09592.
|
RNA g-quadruplex from the 5'-utr of human tyrosine
kinase 2 (tyk2) . ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
8qkx
|
DNA |
NMR |
Agustin DF, Vianney YM, Weisz K, Wahjudi M |
(2024) "Structural Aspects of Split G-Quadruplexes in
Quadruplex-Duplex Hybrid Systems."
Chemistryselect. doi: 10.1002/slct.202304286.
|
Solution structure of a bimolecular quadruplex-duplex
hybrid containing a v-shaped loop . ➥ 3
G-tetrads, 1 G4 helix, 1 G4 stem, UDUU, hybrid3,
3+1
|
|
8qn2
|
gene regulation |
X-ray (2.51 Å) |
Koenig A, Laffile V, Largy E, Thore S, Mackereth C,
Ferrand Y, Gabelica V |
(2025) "Helical aromatic oligoamide foldamers as
selective G-quadruplex ligands." Nucleic Acids
Res. doi: 10.1093/nar/gkaf1365.
|
Helical foldamers as selective g-quadruplex ligands .
➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
8r4e
|
DNA |
NMR |
Jana J, Vianney YM, Weisz K |
(2024) "Impact
of loop length and duplex extensions on the design of
hybrid-type G-quadruplexes."
Chem.Commun.(Camb.), 60,
854-857. doi: 10.1039/d3cc05625b.
|
Hybrid-1r g-quadruplex with a +(lpp) loop progression .
➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UDDD, hybrid4, 1+3, 3(+Ln+P+P)
|
|
8r4w
|
DNA |
NMR |
Jana J, Vianney YM, Weisz K |
(2024) "Impact
of loop length and duplex extensions on the design of
hybrid-type G-quadruplexes."
Chem.Commun.(Camb.), 60,
854-857. doi: 10.1039/d3cc05625b.
|
(3+1) hybrid-2 g-quadruplex with a -(llp) loop
progression . ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UDUU, hybrid3, 3+1, 3(-Lw-Ln-P)
|
|
8r6d
|
DNA |
NMR |
Vianney YM, Dierks D, Weisz K |
(2024) "Structural
Differences at Quadruplex-Duplex Interfaces Enable
Ligand-Induced Topological Transitions." Adv
Sci, 11, e2309891. doi: 10.1002/advs.202309891.
|
A quadruplex-duplex hybrid with a three-layered
hybrid-2 g-quadruplex topology . ➥ 3
G-tetrads, 1 G4 helix, 1 G4 stem, UDUU, hybrid3, 3+1,
3(-Lw-Ln-P)
|
|
8r6g
|
DNA |
NMR |
Vianney YM, Dierks D, Weisz K |
(2024) "Structural
Differences at Quadruplex-Duplex Interfaces Enable
Ligand-Induced Topological Transitions." Adv
Sci, 11, e2309891. doi: 10.1002/advs.202309891.
|
A quadruplex-duplex hybrid with a three-layered chair
g-quadruplex topology . ➥
3 G-tetrads, 1 G4 helix,
1 G4 stem, UDUD, anti-parallel:chair, 2+2,
3(-Lw-Ln-Lw)
|
|
8r6h
|
DNA |
NMR |
Vianney YM, Dierks D, Weisz K |
(2024) "Structural
Differences at Quadruplex-Duplex Interfaces Enable
Ligand-Induced Topological Transitions." Adv
Sci, 11, e2309891. doi: 10.1002/advs.202309891.
|
A quadruplex-duplex hybrid with a three-layered
hybrid-2 g-quadruplex topology complexed with phen-dc3
. ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UDUU, hybrid3, 3+1, 3(-Lw-Ln-P)
|
|
8rw2
|
DNA |
NMR |
Vianney YM, Jana J, Weisz K |
(2024) "A
pH-Responsive Topological Switch Based on a DNA
Quadruplex-Duplex Hybrid." Chemistry,
30, e202400722. doi: 10.1002/chem.202400722.
|
Structure of a chair-type antiparallel
quadruplex-duplex hybrid at ph 6 . ➥ 3
G-tetrads, 1 G4 helix, 1 G4 stem, UDUD,
anti-parallel:chair, 2+2, 3(-Lw-Ln-Lw)
|
|
8rzx
|
DNA |
NMR |
Chatterjee O, Jana J, Panda S, Dutta A, Sharma A,
Saurav S, Motiani RK, Weisz K, Chatterjee S |
(2024) "Remodeling
Ca 2+ dynamics by targeting a promising E-box
containing G-quadruplex at ORAI1 promoter in
triple-negative breast cancer." Cell
Calcium, 123, 102944. doi:
10.1016/j.ceca.2024.102944.
|
Solution structure of a parallel stranded g-quadruplex
formed in orai1 promoter . ➥
3 G-tetrads, 1 G4 helix,
1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
8s1w
|
DNA |
NMR |
Vianney YM, Jana J, Weisz K |
(2024) "A
pH-Responsive Topological Switch Based on a DNA
Quadruplex-Duplex Hybrid." Chemistry,
30, e202400722. doi: 10.1002/chem.202400722.
|
Structure of a quadruplex-duplex hybrid with a (-pd+l)
loop progression . ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUD, hybrid2, 3+1, 3(-PD+Lw)
|
|
8t8t
|
DNA |
X-ray (1.62 Å) |
Martin KN, Lam G, Reznichenko O, Brunner KE, Zdilla
MJ, McCarthy SE, Granzhan A, Yatsunyk LA |
(2025) "Conformational
Change in a Four-Tetrad DNA G-Quadruplex upon
Intercalation of a Small-Molecule Ligand PyDH2."
Angew.Chem.Int.Ed.Engl., 64,
e202501443. doi: 10.1002/anie.202501443.
|
Crystal structure of tet25 in complex with pydh2 ligand
in p212121 space group . ➥
4 G-tetrads, 1 G4 helix,
1 G4 stem, UDUD, anti-parallel:chair, 2+2,
4(+Ln+Lw+Ln)
|
|
8taa
|
DNA |
X-ray (1.45 Å) |
Seth P, Xing E, Hendrickson AD, Li K, Monsen R,
Chaires JB, Neidle S, Yatsunyk LA |
(2025) "Interaction
of N-methylmesoporphyrin IX with a hybrid
left-/right-handed G-quadruplex motif from the promoter
of the SLC2A1 gene." Nucleic Acids Res.,
53. doi: 10.1093/nar/gkae1208.
|
Right-left hybrid parallel g-quadruplex in complex with
n-methyl mesoporphyrin . ➥
4 G-tetrads, 1 G4 helix,
1 G4 stem, UUUU, parallel, 4+0, 2(-P-P-P)
|
|
8tns
|
RNA |
multiple methods: solution nmr, solution
scattering |
Escobar CA, Petersen RJ, Tonelli M, Fan L,
Henzler-Wildman KA, Butcher SE |
(2023) "Solution
Structure of Poly(UG) RNA." J.Mol.Biol.,
435, 168340. doi: 10.1016/j.jmb.2023.168340.
|
Solution structure of poly(ug) RNA (gu)12 g-quadruplex
. ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 2(-P-P-P), negative
twist
|
|
8tqs
|
blood clotting |
X-ray (2.207 Å) |
Yu H, Kumar S, Frederiksen JW, Kolyadko VN, Pitoc G,
Layzer J, Yan A, Rempel R, Francis S, Krishnaswamy S,
Sullenger BA |
(2024) "Aptameric
hirudins as selective and reversible EXosite-ACTive
site (EXACT) inhibitors." Nat Commun,
15, 3977. doi: 10.1038/s41467-024-48211-6.
|
Complex of human thrombin (s195a) bound to a bivalent
inhibitor comprised of DNA aptamer hd22 conjugated to
dabigatran with a linker. . ➥
1 G-tetrad
|
|
8tvz
|
RNA |
cryo-EM (5.94 Å) |
Vallina NS, McRae EKS, Geary C, Andersen ES |
(2024) "An RNA
origami robot that traps and releases a fluorescent
aptamer." Sci Adv, 10,
eadk1250. doi: 10.1126/sciadv.adk1250.
|
RNA origami 3-helix tile traptamer . ➥ 2
G-tetrads, 1 G4 helix, 1 G4 stem, UUDD,
anti-parallel:basket2, 2+2, 2(-P+P)
|
|
8twh
|
DNA |
X-ray (2.47 Å) |
Lam G, Martin KN, Yatsunyk LA |
"Crystal structure of (GGGTT)3GGG G-quadruplex in
complex with small molecule ligand RHPS4." |
Crystal structure of (gggtt)3ggg g-quadruplex in
complex with small molecule ligand rhps4 . ➥ 3
G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0,
3(-P-P-P)
|
|
8u5j
|
RNA |
X-ray (1.7 Å) |
Lu X, Passalacqua LFM, Nodwell M, Kong KYS,
Caballero-Garcia G, Dolgosheina EV, Ferre-D'Amare AR,
Britton R, Unrau PJ |
(2024) "Symmetry
breaking of fluorophore binding to a G-quadruplex
generates an RNA aptamer with picomolar KD."
Nucleic Acids Res., 52,
8039-8051. doi: 10.1093/nar/gkae493.
|
Structure of mango iii variant aptamer bound to
t01-07m-b . ➥ 2 G-tetrads, 1 G4 helix, 1 G4
stem, UUUD, hybrid2, 3+1, 2(-P-P-Lw)
|
|
8u5k
|
RNA |
X-ray (2.8 Å) |
Lu X, Passalacqua LFM, Nodwell M, Kong KYS,
Caballero-Garcia G, Dolgosheina EV, Ferre-D'Amare AR,
Britton R, Unrau PJ |
(2024) "Symmetry
breaking of fluorophore binding to a G-quadruplex
generates an RNA aptamer with picomolar KD."
Nucleic Acids Res., 52,
8039-8051. doi: 10.1093/nar/gkae493.
|
Structure of mango ii aptamer bound to t01-6a .
➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
8u5p
|
RNA |
X-ray (2.9 Å) |
Lu X, Passalacqua LFM, Nodwell M, Kong KYS,
Caballero-Garcia G, Dolgosheina EV, Ferre-D'Amare AR,
Britton R, Unrau PJ |
(2024) "Symmetry
breaking of fluorophore binding to a G-quadruplex
generates an RNA aptamer with picomolar KD."
Nucleic Acids Res., 52,
8039-8051. doi: 10.1093/nar/gkae493.
|
Structure of mango ii aptamer bound to t01-6a-b .
➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
8u5r
|
RNA |
X-ray (2.6 Å) |
Lu X, Passalacqua LFM, Nodwell M, Kong KYS,
Caballero-Garcia G, Dolgosheina EV, Ferre-D'Amare AR,
Britton R, Unrau PJ |
(2024) "Symmetry
breaking of fluorophore binding to a G-quadruplex
generates an RNA aptamer with picomolar KD."
Nucleic Acids Res., 52,
8039-8051. doi: 10.1093/nar/gkae493.
|
Structure of mango ii variant aptamer bound to t01-6a .
➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
8u5t
|
RNA |
X-ray (2.2 Å) |
Lu X, Passalacqua LFM, Nodwell M, Kong KYS,
Caballero-Garcia G, Dolgosheina EV, Ferre-D'Amare AR,
Britton R, Unrau PJ |
(2024) "Symmetry
breaking of fluorophore binding to a G-quadruplex
generates an RNA aptamer with picomolar KD."
Nucleic Acids Res., 52,
8039-8051. doi: 10.1093/nar/gkae493.
|
Structure of mango ii variant aptamer bound to t01-6a-b
. ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
8u5z
|
RNA |
X-ray (2.5 Å) |
Lu X, Passalacqua LFM, Nodwell M, Kong KYS,
Caballero-Garcia G, Dolgosheina EV, Ferre-D'Amare AR,
Britton R, Unrau PJ |
(2024) "Symmetry
breaking of fluorophore binding to a G-quadruplex
generates an RNA aptamer with picomolar KD."
Nucleic Acids Res., 52,
8039-8051. doi: 10.1093/nar/gkae493.
|
Structure of mango ii variant aptamer bound to t01-7m-b
. ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
8u60
|
RNA |
X-ray (3.3 Å) |
Lu X, Passalacqua LFM, Nodwell M, Kong KYS,
Caballero-Garcia G, Dolgosheina EV, Ferre-D'Amare AR,
Britton R, Unrau PJ |
(2024) "Symmetry
breaking of fluorophore binding to a G-quadruplex
generates an RNA aptamer with picomolar KD."
Nucleic Acids Res., 52,
8039-8051. doi: 10.1093/nar/gkae493.
|
Structure of mango ii variant2 aptamer bound to t01-6a
. ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
8utg
|
RNA |
X-ray (1.97 Å) |
Terrell JR, Le TT, Paul A, Brinton MA, Wilson WD,
Poon GMK, Germann MW, Siemer JL |
(2024) "Structure
of an RNA G-quadruplex from the West Nile virus
genome." Nat Commun, 15,
5428. doi: 10.1038/s41467-024-49761-5.
|
An RNA g-quadruplex from the ns5 gene in the west nile
virus genome . ➥ 2 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 2(-P-P-P)
|
|
8vjt
|
RNA |
X-ray (1.052 Å) |
Roschdi S, Montemayor EJ, Vivek R, Bingman CA,
Butcher SE |
(2024) "Self-assembly
and condensation of intermolecular poly(UG) RNA
quadruplexes." Nucleic Acids Res.,
52, 12582-12591. doi: 10.1093/nar/gkae870.
|
Structure of the poly-ug quadruplex (gugugu)4 .
➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0
|
|
8vv2
|
hydrolase-RNA |
cryo-EM (2.6 Å) |
Banco MT, Paul T, Jiang J, Myong S, Ferre-D'Amare
AR |
"Inter-domain synergy enables both DNA and RNA
G-quadruplex unwinding by the DEAH-box helicase
DHX36." |
cryo-EM structure of dhx36 bound to a RNA g-quadruplex
derived from the cmyc g-quadruplex, class 1 .
➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0,
|
|
8vvd
|
motor protein-RNA |
cryo-EM (3.0 Å) |
Banco MT, Paul T, Jiang J, Myong S, Ferre-D'Amare
AR |
"Inter-domain synergy enables both DNA and RNA
G-quadruplex unwinding by the DEAH-box helicase
DHX36." |
cryo-EM structure of dhx36 bound to a RNA g-quadruplex
derived from the cmyc g-quadruplex, class 2 .
➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0,
|
|
8vx1
|
motor protein |
cryo-EM (3.4 Å) |
Banco MT, Paul T, Jiang J, Myong S, Ferre-D'Amare
AR |
(2025) "Structural
basis for dual DNA and RNA specificity of the
G-quadruplex-resolving DEAH-box helicase DHX36."
Cell Rep, 44, 116136. doi:
10.1016/j.celrep.2025.116136.
|
cryo-EM structure of dhx36 bound to the cmyc DNA
g-quadruplex, class 2 . ➥
6 G-tetrads, 1 G4 helix,
2 G4 stems, 1 G4 coaxial stack, UUUU, parallel, 4+0,
3(-P-P); UUUU, parallel, 4+0, 3(-P-P-P), coaxial
interfaces: 5'/5'
|
|
8vx8
|
motor protein |
cryo-EM (3.4 Å) |
Banco MT, Paul T, Jiang J, Myong S, Ferre-D'Amare
AR |
(2025) "Structural
basis for dual DNA and RNA specificity of the
G-quadruplex-resolving DEAH-box helicase DHX36."
Cell Rep, 44, 116136. doi:
10.1016/j.celrep.2025.116136.
|
cryo-EM structure of dhx36 bound to the cmyc DNA
g-quadruplex, class 1 . ➥
6 G-tetrads, 1 G4 helix,
2 G4 stems, 1 G4 coaxial stack, UUUU, parallel, 4+0, ;
UUUU, parallel, 4+0, 3(-P), coaxial interfaces:
5'/5'
|
|
8vxx
|
RNA |
X-ray (3.1 Å) |
Yang M, Prestwood PR, Passalacqua LFM, Balaratnam S,
Fullenkamp CR, Arney JW, Weeks KM, Ferre-D'Amare A,
Schneekloth Jr JS |
(2025) "Structure-informed
design of an ultrabright RNA-activated
fluorophore." Nat.Chem.,
17, 1188-1195. doi: 10.1038/s41557-025-01832-w.
|
Mango ii bound to 365a-061 . ➥
9 G-tetrads, 2 G4
helices, 3 G4 stems, 1 G4 coaxial stack, UUUU,
parallel, 4+0, 3(-P-P-P), coaxial interfaces: 5'/5'
|
|
8vxz
|
RNA |
X-ray (3.0 Å) |
Yang M, Prestwood PR, Passalacqua LFM, Balaratnam S,
Fullenkamp CR, Arney JW, Weeks KM, Ferre-D'Amare A,
Schneekloth Jr JS |
(2025) "Structure-informed
design of an ultrabright RNA-activated
fluorophore." Nat.Chem.,
17, 1188-1195. doi: 10.1038/s41557-025-01832-w.
|
Mango ii bound to 365a-084 . ➥
6 G-tetrads, 1 G4 helix,
2 G4 stems, 1 G4 coaxial stack, UUUU, parallel, 4+0,
3(-P-P-P), coaxial interfaces: 5'/5'
|
|
8vy0
|
RNA |
X-ray (3.1 Å) |
Yang M, Prestwood PR, Passalacqua LFM, Balaratnam S,
Fullenkamp CR, Arney JW, Weeks KM, Ferre-D'Amare A,
Schneekloth Jr JS |
(2025) "Structure-informed
design of an ultrabright RNA-activated
fluorophore." Nat.Chem.,
17, 1188-1195. doi: 10.1038/s41557-025-01832-w.
|
Mango ii bound to 365a-087 . ➥
9 G-tetrads, 2 G4
helices, 3 G4 stems, 1 G4 coaxial stack, UUUU,
parallel, 4+0, 3(-P-P-P), coaxial interfaces: 5'/5'
|
|
8vy1
|
RNA |
X-ray (3.1 Å) |
Yang M, Prestwood PR, Passalacqua LFM, Balaratnam S,
Fullenkamp CR, Arney JW, Weeks KM, Ferre-D'Amare A,
Schneekloth Jr JS |
(2025) "Structure-informed
design of an ultrabright RNA-activated
fluorophore." Nat.Chem.,
17, 1188-1195. doi: 10.1038/s41557-025-01832-w.
|
Mango ii bound to 365a-088 . ➥
9 G-tetrads, 2 G4
helices, 3 G4 stems, 1 G4 coaxial stack, UUUU,
parallel, 4+0, 3(-P-P-P), coaxial interfaces: 5'/5'
|
|
8wa4
|
DNA |
NMR |
Xiao CM, Li YP, Liu YS, Dong RF, He XY, Lin Q, Zang
X, Wang KB, Xia YZ, Kong LY |
"Stabilizing ATF4 promoter G-quadruplex overcomes the
resistance of glutamine-restricted cancer therapy." |
Solution structure of free atf4 promoter g-quadruplex .
➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
8x0s
|
RNA |
X-ray (2.956 Å) |
Geng Y, Liu C, Xu N, Suen MC, Miao H, Xie Y, Zhang B,
Chen X, Song Y, Wang Z, Cai Q, Zhu G |
(2024) "Crystal
structure of a tetrameric RNA G-quadruplex formed by
hexanucleotide repeat expansions of C9orf72 in
ALS/FTD." Nucleic Acids Res.,
52, 7961-7970. doi: 10.1093/nar/gkae473.
|
Crystal structure of r(g4c2)2 . ➥ 8
G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack,
UUUU, parallel, 4+0, coaxial interfaces: 5'/5'
|
|
8x1v
|
DNA |
NMR |
Wang Y, Wang J, Yan Z, Hou J, Wan L, Yang Y, Liu Y,
Yi J, Guo P, Han D |
(2024) "Structural
investigation of pathogenic RFC1 AAGGG pentanucleotide
repeats reveals a role of G-quadruplex in dysregulated
gene expression in CANVAS." Nucleic Acids
Res., 52, 2698-2710. doi:
10.1093/nar/gkae032.
|
NMR structure of a bimolecular parallel g-quadruplex
formed by aaggg repeats from pathogenic rfc1 gene .
➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0
|
|
8xak
|
hydrolase-DNA |
X-ray (3.5 Å) |
Hong Z, Byrd AK, Gao J, Das P, Tan VQ, Malone EG,
Osei B, Marecki JC, Protacio RU, Wahls WP, Raney KD, Song
H |
(2024) "Eukaryotic
Pif1 helicase unwinds G-quadruplex and dsDNA using a
conserved wedge." Nat Commun,
15, 6104. doi: 10.1038/s41467-024-50575-8.
|
Structure of pif1-g4 complex . ➥ 4
G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack,
UUUU, parallel, 4+0, 2(-P-P-P), coaxial interfaces:
3'/5'
|
|
8xgp
|
DNA |
NMR |
Yan Z, He A, Wan L, Gao Q, Jiang Y, Wang Y, Wang E,
Li C, Yang Y, Li Y, Guo P, Han D |
(2025) "Structural
Insights into an Antiparallel Chair-Type G-Quadruplex
From the Intron of NOP56 Oncogene." Adv
Sci, 12, e2406230. doi: 10.1002/advs.202406230.
|
Solution NMR structure of an antiparallel chair-type
g-quadruplex from nop56 intron . ➥ 3
G-tetrads, 1 G4 helix, 1 G4 stem, UDUD,
anti-parallel:chair, 2+2, 3(-Lw-Ln-Lw)
|
|
8y2r
|
DNA |
NMR |
Xiao C, Li Y, Liu Y, Dong R, He X, Lin Q, Zang X,
Wang K, Xia Y, Kong L |
(2024) "Overcoming
Cancer Persister Cells by Stabilizing the ATF4 Promoter
G-quadruplex." Adv Sci,
11, e2401748. doi: 10.1002/advs.202401748.
|
NMR solution structure of the 2:1 coptisine-atf4-g4
complex . ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
8yu3
|
DNA |
NMR |
Liu W, Zhu BC, Liu LY, Xia XY, Jang J, Dickerhoff J,
Yang D, Mao ZW |
(2024) "Solution
structures and effects of a platinum compound
successively bound MYC G-quadruplex." Nucleic
Acids Res., 52, 9397-9406. doi:
10.1093/nar/gkae649.
|
NMR solution structure of the 2:1 complex of a
platinum(ii) compound bound to myc1234 g-quadruplex .
➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUDU, hybrid1, 3+1, 3(-P-Lw-Ln)
|
|
8zve
|
DNA |
NMR |
Tang ZY, Li SR, Bian YT, Chen ZY, Wang YY, Zhang YQ,
Li YP, Liu YS, Yang MH, Kong LY, Wang KB |
"NMR Solution Structure of the Major TMPRSS2 Promoter
G-Quadruplex and Its Complex with Berberine." |
Solution structure of free tmprss2 promoter
g-quadruplex . ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
8zw3
|
DNA |
NMR |
Tang ZY, Li SR, Bian YT, Chen ZY, Wang YY, Zhang YQ,
Li YP, Liu YS, Yang MH, Kong LY, Wang KB |
"NMR Solution Structure of the Major TMPRSS2 Promoter
G-Quadruplex and Its Complex with Berberine." |
Solution structure of tmprss2 promoter g-quadruplex .
➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
9b6z
|
DNA |
NMR |
Liu W, Zhu BC, Liu LY, Xia XY, Jang J, Dickerhoff J,
Yang D, Mao ZW |
(2024) "Solution
structures and effects of a platinum compound
successively bound MYC G-quadruplex." Nucleic
Acids Res., 52, 9397-9406. doi:
10.1093/nar/gkae649.
|
NMR solution structure of the 1:1 complex of a
platinum(ii) compound bound to myc1234 g-quadruplex .
➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUDU, hybrid1, 3+1, 3(-P-Lw-Ln)
|
|
9c46
|
DNA |
X-ray (2.39 Å) |
Seth P, Xing E, Hendrickson AD, Li K, Monsen R,
Chaires JB, Neidle S, Yatsunyk LA |
(2025) "Interaction
of N-methylmesoporphyrin IX with a hybrid
left-/right-handed G-quadruplex motif from the promoter
of the SLC2A1 gene." Nucleic Acids Res.,
53. doi: 10.1093/nar/gkae1208.
|
Right-left hybrid parallel g-quadruplex from slc2a1
promoter . ➥ 4 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 2(-P-P-P)
|
|
9c73
|
DNA |
X-ray (1.66 Å) |
Ali A, Yatsunyk LA |
"Hybrid G-quadruplex from Tetrahymena thermophila
telomeric sequence in complex with triangular star shaped
TrisQ ligand." |
Hybrid g-quadruplex from tetrahymena thermophila
telomeric sequence in complex with trisqo .
➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUDU, hybrid1, 3+1, 3(-P-Lw-Ln)
|
|
9cb5
|
transcription-DNA |
X-ray (2.6 Å) |
Chen L, Dickerhoff J, Zheng KW, Erramilli S, Feng H,
Wu G, Onel B, Chen Y, Wang KB, Carver M, Lin C, Sakai S,
Wan J, Vinson C, Hurley L, Kossiakoff AA, Deng N, Bai Y,
Noinaj N, Yang D |
(2025) "Structural
basis for nucleolin recognition of MYC promoter
G-quadruplex." Science,
388, eadr1752. doi: 10.1126/science.adr1752.
|
Crystal structure of nucleolin in complex with myc
promoter g-quadruplex . ➥
3 G-tetrads, 1 G4 helix,
1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
9ciy
|
DNA |
X-ray (2.4 Å) |
Xing ER, Yatsunyk LA |
"Structure of a left-right-handed G-quadruplex from
the promoter of the NSD1 gene." |
Right-left hybrid parallel g-quadruplex from nsd1
promoter . ➥ 4 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 2(-P-P-P)
|
|
9dqe
|
DNA |
NMR |
Wang YY, Bian YT, Chen XY, Li JZ, Liu YS, Kong LY,
Wang KB |
"BLM G-quadruplex stabilizers synergize with PARP
inhibitor to kill BRCA wild-type colon cancer
cells." |
NMR solution structure of the 2:1 coptisine- blm-g4
complex . ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
9e2w
|
replication-DNA |
cryo-EM (3.3 Å) |
Batra S, Allwein B, Kumar C, Devbhandari S, Bruning
JG, Bahng S, Lee CM, Marians KJ, Hite RK, Remus D |
(2025) "G-quadruplex-stalled
eukaryotic replisome structure reveals helical inchworm
DNA translocation." Science,
387, eadt1978. doi: 10.1126/science.adt1978.
|
cryo-EM structure of yeast cmg helicase stalled at
g4-containing DNA template, state 1 . ➥ 3
G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0,
3(-P-P-P)
|
|
9e2x
|
replication-DNA |
cryo-EM (3.5 Å) |
Batra S, Allwein B, Kumar C, Devbhandari S, Bruning
JG, Bahng S, Lee CM, Marians KJ, Hite RK, Remus D |
(2025) "G-quadruplex-stalled
eukaryotic replisome structure reveals helical inchworm
DNA translocation." Science,
387, eadt1978. doi: 10.1126/science.adt1978.
|
cryo-EM structure of yeast cmg helicase stalled at
g4-containing DNA template, state 2 . ➥ 3
G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0,
3(-P-P-P)
|
|
9e2y
|
replication-DNA |
cryo-EM (3.2 Å) |
Batra S, Allwein B, Kumar C, Devbhandari S, Bruning
JG, Bahng S, Lee CM, Marians KJ, Hite RK, Remus D |
(2025) "G-quadruplex-stalled
eukaryotic replisome structure reveals helical inchworm
DNA translocation." Science,
387, eadt1978. doi: 10.1126/science.adt1978.
|
cryo-EM structure of yeast cmg helicase stalled at
g4-containing DNA template, state 3 . ➥ 3
G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0,
3(-P-P-P)
|
|
9e2z
|
replication-DNA |
cryo-EM (2.6 Å) |
Batra S, Allwein B, Kumar C, Devbhandari S, Bruning
JG, Bahng S, Lee CM, Marians KJ, Hite RK, Remus D |
(2025) "G-quadruplex-stalled
eukaryotic replisome structure reveals helical inchworm
DNA translocation." Science,
387, eadt1978. doi: 10.1126/science.adt1978.
|
cryo-EM structure of human cmg helicase stalled at
g4-containing DNA template . ➥
3 G-tetrads, 1 G4 helix,
1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
9e8e
|
DNA |
X-ray (1.65 Å) |
Ali A, Yatsunyk LA |
"Hybrid G-quadruplex from Tetrahymena thermophila
telomeric sequence in complex with triangular star shaped
TrisQ ligand." |
Hybrid g-quadruplex from tetrahymena thermophila
telomeric sequence in complex with trisqo form 2 .
➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUDU, hybrid1, 3+1, 3(-P-Lw-Ln)
|
|
9ehb
|
DNA |
X-ray (2.03 Å) |
Kuo YA, Chen YI, Siraj N, He Y, Yang Z, Wang Y,
Batchelder-Schwab EJ, Korkmaz Z, Yonas S, Nguyen TD, Hong
S, Nguyen AT, Kim S, Seifi S, Fan PH, Wu Y, Liu HW, Lu Y,
Ren P, Mao C, Yeh HC |
(2026) "Fluorogenic
Aptamer Optimization on a Massively Parallel Sequencing
Platform." ACS Sens. doi: 10.1021/acssensors.5c04046.
|
Structure of short lettuce aptamer (c14t variant) bound
with to1-biotin. . ➥ 2 G-tetrads, 1 G4 helix, 1 G4
stem, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
|
|
9ehc
|
DNA |
X-ray (1.5 Å) |
Kuo YA, Chen YI, Siraj N, He Y, Yang Z, Wang Y,
Batchelder-Schwab EJ, Korkmaz Z, Yonas S, Nguyen TD, Hong
S, Nguyen AT, Kim S, Seifi S, Fan PH, Wu Y, Liu HW, Lu Y,
Ren P, Mao C, Yeh HC |
(2026) "Fluorogenic
Aptamer Optimization on a Massively Parallel Sequencing
Platform." ACS Sens. doi: 10.1021/acssensors.5c04046.
|
Structure of short lettuce aptamer bound to
to1-3peg-biotin . ➥ 2 G-tetrads, 1 G4 helix, 1 G4
stem, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
|
|
9ehe
|
DNA |
X-ray (1.63 Å) |
Kuo YA, Chen YI, Siraj N, He Y, Yang Z, Wang Y,
Batchelder-Schwab EJ, Korkmaz Z, Yonas S, Nguyen TD, Hong
S, Nguyen AT, Kim S, Seifi S, Fan PH, Wu Y, Liu HW, Lu Y,
Ren P, Mao C, Yeh HC |
(2026) "Fluorogenic
Aptamer Optimization on a Massively Parallel Sequencing
Platform." ACS Sens. doi: 10.1021/acssensors.5c04046.
|
Structure of short lettuce aptamer (a5t variant) bound
with to1-biotin. . ➥ 2 G-tetrads, 1 G4 helix, 1 G4
stem, UDUD, anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
|
|
9eoq
|
DNA |
cryo-EM (7.5 Å) |
Khoshouei A, Kempf G, Mykhailiuk V, Griessing JM,
Honemann MN, Kater L, Cavadini S, Dietz H |
(2024) "Designing
Rigid DNA Origami Templates for Molecular Visualization
Using Cryo-EM." Nano Lett.,
24, 5031-5038. doi: 10.1021/acs.nanolett.4c00915.
|
cryo-EM structure of a 1033 scaffold base DNA origami
nanostructure v4 and tba . ➥
1 G-tetrad
|
|
9fta
|
DNA |
X-ray (2.49 Å) |
Sbirkova-Dimitrova HI, Shivachev BL |
"Crystal structure of d(GGGGTTTTGGGG) with Zn and
K." |
Crystal structure of d(ggggttttgggg) with zn and k .
➥ 8 G-tetrads, 2 G4 helices, 2 G4
stems, UDDU, anti-parallel:basket, 2+2
|
|
9gvi
|
DNA |
NMR |
Ghosh A, Harnos J, Stadlbauer P, Sponer J, Lenarcic
Zivkovic M, Trantirek L |
(2025) "Structural
basis of bis-quinolinium ligands binding to
quadruplex-duplex hybrids from PIM1 oncogene."
Nucleic Acids Res., 53. doi:
10.1093/nar/gkaf894.
|
Quadruplex-duplex hybrids (qdh) complex with phendc3
from pim1 oncogene. . ➥
3 G-tetrads, 1 G4 helix,
1 G4 stem, UUDU, hybrid1, 3+1, 3(-P-Lw-Ln)
|
|
9gvv
|
DNA |
NMR |
Ghosh A, Harnos J, Stadlbauer P, Sponer J, Lenarcic
Zivkovic M, Trantirek L |
(2025) "Structural
basis of bis-quinolinium ligands binding to
quadruplex-duplex hybrids from PIM1 oncogene."
Nucleic Acids Res., 53. doi:
10.1093/nar/gkaf894.
|
Quadruplex-duplex hybrid (qdh) complex with 360a from
pim1 oncogene. . ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUDU, hybrid1, 3+1, 3(-P-Lw-Ln)
|
|
9gxh
|
immune system |
X-ray (1.9 Å) |
Pevec M, Medved T, Kovacic M, Zerjav N, Imperl J,
Plavec J, Lah J, Loris R, Hadzi S |
(2025) "Structural
basis of G-quadruplex recognition by a camelid antibody
fragment." Nucleic Acids Res.,
53. doi: 10.1093/nar/gkaf453.
|
Nanobody bound to tba g-quadruplex . ➥ 2
G-tetrads, 1 G4 helix, 1 G4 stem, UDUD,
anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
|
|
9hrd
|
RNA |
X-ray (2.5 Å) |
Stafflinger H, Neissner K, Bartsch S, Pichler AK,
Bartosik K, Dhamotharan K, Abele R, Duchardt-Ferner E,
Micura R, Schindelin H, Wohnert J |
(2025) "Crystal
structure of the class V GTP-binding RNA aptamer bound
to its ligand: GTP recognition by a topologically
complex intermolecular G-quadruplex." Nucleic
Acids Res., 53. doi: 10.1093/nar/gkaf1315.
|
Crystal structure of the class v gtp aptamer in complex
with gtp . ➥ 4 G-tetrads, 2 G4 helices
|
|
9hrf
|
RNA |
X-ray (1.6 Å) |
Stafflinger H, Neissner K, Bartsch S, Pichler AK,
Bartosik K, Dhamotharan K, Abele R, Duchardt-Ferner E,
Micura R, Schindelin H, Wohnert J |
(2025) "Crystal
structure of the class V GTP-binding RNA aptamer bound
to its ligand: GTP recognition by a topologically
complex intermolecular G-quadruplex." Nucleic
Acids Res., 53. doi: 10.1093/nar/gkaf1315.
|
Crystal structure of the class v (uu) gtp aptamer
variant in complex with gtp . ➥ 2
G-tetrads, 1 G4 helix
|
|
9hrg
|
RNA |
X-ray (2.05 Å) |
Stafflinger H, Neissner K, Bartsch S, Pichler AK,
Bartosik K, Dhamotharan K, Abele R, Duchardt-Ferner E,
Micura R, Schindelin H, Wohnert J |
(2025) "Crystal
structure of the class V GTP-binding RNA aptamer bound
to its ligand: GTP recognition by a topologically
complex intermolecular G-quadruplex." Nucleic
Acids Res., 53. doi: 10.1093/nar/gkaf1315.
|
Crystal structure of the class v (g61a) gtp aptamer
variant in complex with gtp . ➥ 4
G-tetrads, 2 G4 helices
|
|
9i1p
|
hydrolase |
X-ray (3.2 Å) |
Song ZY, Zhang X, Ai X, Huang LY, Hou XM, Fosse P,
Liu NN, Mauffret O, Rety S, Xi XG |
(2025) "Structural
mechanism of RECQ1 helicase in unfolding G-quadruplexes
compared with duplex DNA." Nucleic Acids
Res., 53. doi: 10.1093/nar/gkaf877.
|
Structure of recql- myc g-quadruplex - adp complex from
bos taurus . ➥ 6 G-tetrads, 2 G4 helices, 2 G4
stems, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
9i22
|
hydrolase |
X-ray (2.42 Å) |
Song ZY, Zhang X, Ai X, Huang LY, Hou XM, Fosse P,
Liu NN, Mauffret O, Rety S, Xi XG |
(2025) "Structural
mechanism of RECQ1 helicase in unfolding G-quadruplexes
compared with duplex DNA." Nucleic Acids
Res., 53. doi: 10.1093/nar/gkaf877.
|
Structure of human helicase recq1- myc g-quadruplex -
adp complex . ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
9i23
|
hydrolase |
X-ray (3.69 Å) |
Song ZY, Zhang X, Ai X, Huang LY, Hou XM, Fosse P,
Liu NN, Mauffret O, Rety S, Xi XG |
(2025) "Structural
mechanism of RECQ1 helicase in unfolding G-quadruplexes
compared with duplex DNA." Nucleic Acids
Res., 53. doi: 10.1093/nar/gkaf877.
|
Structure of human helicase recq1- 795-2t g-quadruplex
- adp complex . ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
9i5s
|
DNA |
NMR |
Avendano Avila C, Heddi B |
(2025) "An
antiparallel G-quadruplex structure with a 5'-end
overhang forms predominantly at the human telomeric
ds-ss DNA junction." Chem.Commun.(Camb.),
61, 17661-17664. doi: 10.1039/d5cc03633j.
|
Solution structure of an intramolecular anti-parallel
g-quadruplex with a 5'-end overhang. . ➥ 2
G-tetrads, 1 G4 helix, 1 G4 stem, UDDU,
anti-parallel:basket, 2+2, 2(-LwD+Ln)
|
|
9imy
|
DNA |
NMR |
Hu X, Cao C |
"Solution structure of MAX G-quadruplex DNA." |
Solution structure of max1a g-quadruplex DNA .
➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUD, hybrid2, 3+1, 3(-PD+Lw)
|
|
9ji9
|
DNA |
NMR |
Li YP, Zheng Y, Wang YY, Chen XY, Chen RS, Li JZ, Liu
YS, Yang MH, Zhang H, Kong LY, Wang KB |
"Natural alkaloid nitidine stabilizes the major MET
promoter G-quadruplex to disrupt its interaction with
LRPPRC protein for MET oncogene downregulation." |
Solution structure of met promoter g-quadruplex .
➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
9jo0
|
DNA |
NMR |
Wang YY, Bian YT, Chen XY, Li JZ, Liu YS, Kong LY,
Wang KB |
"BLM G-quadruplex stabilizers synergize with PARP
inhibitor to kill BRCA wild-type colon cancer
cells." |
Solution structure of free blm promoter g-quadruplex .
➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
9jo1
|
DNA |
NMR |
Wang YY, Bian YT, Chen XY, Li JZ, Liu YS, Kong LY,
Wang KB |
"BLM G-quadruplex stabilizers synergize with PARP
inhibitor to kill BRCA wild-type colon cancer
cells." |
NMR solution structure of the 2:1 berberine-blm-g4
complex . ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
9jx5
|
DNA |
NMR |
Yan Z, He A, Wan L, Gao Q, Jiang Y, Wang Y, Wang E,
Li C, Yang Y, Li Y, Guo P, Han D |
(2025) "Structural
Insights into an Antiparallel Chair-Type G-Quadruplex
From the Intron of NOP56 Oncogene." Adv
Sci, 12, e2406230. doi: 10.1002/advs.202406230.
|
Solution NMR structure of the 1:1 complex of nop56
intronic g-quadruplex bound with pyridostatin .
➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UDUD, anti-parallel:chair, 2+2, 3(-Lw-Ln-Lw)
|
|
9k70
|
DNA-RNA hybrid |
NMR |
Fu WQ, Zhang N |
"Guanine ribonucleotide atypically adaptive to syn
glycosidic conformation in an RNA-DNA hybrid G-quadruplex
with topologically (3+1) mixed strand orientation." |
A (3+1) hybrid g-quadruplex assembled between two
strands of human telomeric DNA and RNA . ➥ 3
G-tetrads, 1 G4 helix, 1 G4 stem, UDUU, hybrid3,
3+1
|
|
9kcq
|
DNA binding protein |
X-ray (1.77 Å) |
Ngo KH, Heddi B, Winnerdy FR, Phan AT |
"X-ray structure of a G-quadruplex-ankyrin
complex." |
Crystal structure of an ankyrin protein in complex with
g-quadruplex . ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UDDU, anti-parallel:basket, 2+2, 3(-LwD+Ln)
|
|
9kg4
|
DNA |
NMR |
Zhang YQ, Gu W, He SH, Cheng RS, Chen ZY, Yan TD,
Kong LY, Wang KB |
"G146A Mutation in hTERT Promoter Induces a Distinct
G-Quadruplex That Activates hTERT Transcription:
Structure Determination and Its Potential as a Drug
Target." |
Solution structure of free htert promoter g-quadruplex
. ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
9kg8
|
DNA |
NMR |
Zhang YQ, Gu W, He SH, Cheng RS, Chen ZY, Yan TD,
Kong LY, Wang KB |
"G146A Mutation in hTERT Promoter Induces a Distinct
G-Quadruplex That Activates hTERT Transcription:
Structure Determination and Its Potential as a Drug
Target." |
Solution structure of the 2:1 berberine- htert-g4
complex . ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
9l4e
|
DNA |
NMR |
Ni X, Hu XD, Long W, Lan W, Wang C, Wong WL, Cao
C |
(2025) "Molecular
recognition and effects of a benzothiazole derivative
targeting the MYC G-quadruplex." Nucleic Acids
Res., 53. doi: 10.1093/nar/gkaf888.
|
Solution structure of the 2:1 complex between the
benzothiazole derivative bto-28 and the myc
g-quadruplex . ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
9mmf
|
DNA |
X-ray (2.08 Å) |
Eyiolowope J, Xing ER, Yatsunyk LA |
"The first crystal structure of five-tetrad
G-quadruplex." |
First structure of five-tetrad g-quadruplex .
➥ 10 G-tetrads, 2 G4 helices, 2 G4
stems, UDUU, hybrid3, 3+1, 4(-Lw-Ln-P)
|
|
9mxo
|
DNA |
X-ray (1.68 Å) |
Hendrickson AD, Xing ER, Yatsunyk LA |
"Preservation of left-handed fold and interaction
with N-methylmesoporphyrin IX by two-block sequences with
left-hand folding potential." |
Motif2-motif1 left-handed parallel g-quadruplex in h3
spacegroup . ➥ 4 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 2(+P+P+P), negative
twist
|
|
9nap
|
RNA |
cryo-EM (3.01 Å) |
Jones CP, Ferre-D'Amare AR |
"Symmetric scaffolds enable de novo modelling of RNA
by cryoEM." |
RNA scaffold attached to mango in the presence of
to1-biotin . ➥ 2 G-tetrads, 1 G4 helix, 1 G4
stem, UUUD, hybrid2, 3+1, 2(-P-P-Lw)
|
|
9o70
|
DNA |
X-ray (2.02 Å) |
Xing ER, Yatsunyk LA |
"Structure of a left-right-handed G-quadruplex from
the promoter of the NSD1 gene." |
Motif1-motif2, two domain left-handed parallel
g-quadruplex . ➥ 4 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 2(+P+P+P), negative
twist
|
|
9p3a
|
DNA |
X-ray (2.34 Å) |
Xing ER, Yatsunyk LA |
"Preservation of left-handed fold and interaction
with N-methylmesoporphyrin IX by two-block sequences with
left-hand folding potential." |
T-motif1-motif2 right-left hybrid parallel g-quadruplex
in complex with n-methylmesoporphyrin ix . ➥ 4
G-tetrads, 1 G4 helix, 1 G4 stem, UUUU, parallel, 4+0,
2(+P+P+P), negative twist
|
|
9pa0
|
DNA |
NMR |
Dickerhoff J, Yang D |
(2026) "NMR structure study of DNA G-quadruplexes and
ligand complexes." Prog.Nucl.Magn.Reson.
Spectros., 154-155, 101597. doi:
10.1016/j.pnmrs.2026.101597.
|
Hybrid-1 form of human telomere DNA quadruplex with
wild-type 5'-flanking in k+ solution . ➥ 3
G-tetrads, 1 G4 helix, 1 G4 stem, UUDU, hybrid1, 3+1,
3(-P-Lw-Ln)
|
|
9tnq
|
DNA |
NMR |
Trajkovski M, Platella C, Musumeci D, Napolitano E,
Esposito CL, Catuogno S, Plavec J, Montesarchio D |
(2026) "Unraveling
the NMR structures of G-quadruplex-forming aptamers
acting as inhibitors of High Mobility Group Box 1
(HMGB1) pathological activity."
Int.J.Biol.Macromol., 357,
151585. doi: 10.1016/j.ijbiomac.2026.151585.
|
L41 g-quadruplex-forming aptamers targeting hmgb1
protein . ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UDUU, hybrid3, 3+1, 3(-Lw-Ln-P)
|
|
9tnr
|
DNA |
NMR |
Trajkovski M, Platella C, Musumeci D, Napolitano E,
Esposito CL, Catuogno S, Plavec J, Montesarchio D |
(2026) "Unraveling
the NMR structures of G-quadruplex-forming aptamers
acting as inhibitors of High Mobility Group Box 1
(HMGB1) pathological activity."
Int.J.Biol.Macromol., 357,
151585. doi: 10.1016/j.ijbiomac.2026.151585.
|
L12 g-quadruplex-forming aptamer targeting hmgb1
protein . ➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UDUU, hybrid3, 3+1, 3(-Lw-Ln-P)
|
|
9u3i
|
DNA |
X-ray (1.2 Å) |
Park S, Kanazawa H, Kondo J |
"Crystal structure of a phenylalanine-modifi ed
thrombin-binding DNA aptamer." |
Crystal structure of a phenylalanine-modifi ed
thrombin-binding DNA aptamer . ➥ 2
G-tetrads, 1 G4 helix, 1 G4 stem, UDUD,
anti-parallel:chair, 2+2, 2(+Ln+Lw+Ln)
|
|
9u83
|
DNA |
NMR |
Negi D, Sannapureddi RKR, Sathyamoorthy B |
"Molecular Interactions of a Frustrated G-Rich
Sequence: Atomistic Insights into Folding of DNA
G-Quadruplexes." |
Structure of aa(gggtt)3gggaa g-quadruplex in the
presence of sodium ions . ➥
3 G-tetrads, 1 G4 helix,
1 G4 stem, UDUU, hybrid3, 3+1, 3(-Lw-Ln-P)
|
|
9u89
|
DNA |
NMR |
Negi D, Sannapureddi RKR, Sathyamoorthy B |
"Molecular Interactions of a Frustrated G-Rich
Sequence: Atomistic Insights into Folding of DNA
G-Quadruplexes." |
Structure of aa(gggtt)3gggaa g-quadruplex in the
presence of potassium ions . ➥
3 G-tetrads, 1 G4 helix,
1 G4 stem, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
9uk6
|
DNA |
X-ray (1.94 Å) |
Geng Y, Liu C, Miao H, Suen MC, Xie Y, Zhang B, Han
W, Wu C, Ren H, Chen X, Tai HC, Wang Z, Zhu G, Cai Q |
(2025) "Crystal
structures of distinct parallel and antiparallel DNA
G-quadruplexes reveal structural polymorphism in
C9orf72 G4C2 repeats." Nucleic Acids Res.,
53. doi: 10.1093/nar/gkaf879.
|
Dimeric parallel g-quadruplex formed by d(g4c2)4 .
➥ 8 G-tetrads, 1 G4 helix, 2 G4
stems, 1 G4 coaxial stack, UUUU, parallel, 4+0,
4(-P-P-P), coaxial interfaces: 5'/5'
|
|
9uk8
|
DNA |
X-ray (2.7 Å) |
Geng Y, Liu C, Miao H, Suen MC, Xie Y, Zhang B, Han
W, Wu C, Ren H, Chen X, Tai HC, Wang Z, Zhu G, Cai Q |
(2025) "Crystal
structures of distinct parallel and antiparallel DNA
G-quadruplexes reveal structural polymorphism in
C9orf72 G4C2 repeats." Nucleic Acids Res.,
53. doi: 10.1093/nar/gkaf879.
|
Monomeric antiparallel g-quadruplex formed by d(g4c2)4
. ➥ 4 G-tetrads, 1 G4 helix, 1 G4
stem, UDUD, anti-parallel:chair, 2+2, 4(+Ln+Lw+Ln)
|
|
9va0
|
DNA |
NMR |
Li Y, Ji D, Jia Y, Liang Y, Wei E, Gao C, Li Y, Zeng
C, Wang L, Wang C, Guo Z, Zhang Y, Zhou MM, Wu D, Zeng
L |
(2026) "Dual
targeting of topoisomerase I and DNA G-quadruplexes
enhances senescence and chemosensitivity in colorectal
cancer." Commun Biol, 9.
doi: 10.1038/s42003-026-09801-w.
|
Solution NMR structures of htert DNA g-quadruplexes
(g4s) in complex with small molecule cpt-11 .
➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
9va3
|
DNA |
NMR |
Li Y, Ji D, Jia Y, Liang Y, Wei E, Gao C, Li Y, Zeng
C, Wang L, Wang C, Guo Z, Zhang Y, Zhou MM, Wu D, Zeng
L |
(2026) "Dual
targeting of topoisomerase I and DNA G-quadruplexes
enhances senescence and chemosensitivity in colorectal
cancer." Commun Biol, 9.
doi: 10.1038/s42003-026-09801-w.
|
Solution NMR structures of htert DNA g-quadruplexes
(g4s) in complex with small molecule zbh-01 .
➥ 3 G-tetrads, 1 G4 helix, 1 G4
stem, UUUU, parallel, 4+0, 3(-P-P-P)
|
|
9vmz
|
RNA |
X-ray (2.44 Å) |
Peng X, Huang L |
"Crystal structure of Broccoli aptamer in with
BI." |
Crystal structure of broccoli aptamer in with bi .
➥ 4 G-tetrads, 2 G4 helices, 2 G4
stems, UUDD, anti-parallel:basket2, 2+2, 2(-PD+P)
|
|
9whv
|
RNA |
NMR |
Song SS, Yang L, Wang LW, Tian RQ, Wang SY, Jia MH,
Xu Y, Zhong MQ, Liang XG, Hu KL, Luo H, Chen Y, Hu XX,
Shen XC, Xiao CD |
(2026) "An
intra-locked RNA G-quadruplex topology confers enhanced
nuclease resistance and cancer cell targeting."
Int.J.Biol.Macromol., 367,
152564. doi: 10.1016/j.ijbiomac.2026.152564.
|
Cross-stacking-stabilized intra-locked RNA g-quadruplex
. ➥ 6 G-tetrads, 2 G4 helices, 2 G4
stems, UUUU, parallel, 4+0
|