Summary information and primary citation

PDB-id
6b3k
Class
immune system-RNA
Method
X-ray (2.09 Å)
Summary
Crystal structure of mutant spinach RNA aptamer in complex with fab bl3-6
Reference
Koirala D, Shelke SA, Dupont M, Ruiz S, DasGupta S, Bailey LJ, Benner SA, Piccirilli JA (2018): "Affinity maturation of a portable Fab-RNA module for chaperone-assisted RNA crystallography." Nucleic Acids Res., 46, 2624-2635. doi: 10.1093/nar/gkx1292.
Abstract
Antibody fragments such as Fabs possess properties that can enhance protein and RNA crystallization and therefore can facilitate macromolecular structure determination. In particular, Fab BL3-6 binds to an AAACA RNA pentaloop closed by a GC pair with ∼100 nM affinity. The Fab and hairpin have served as a portable module for RNA crystallization. The potential for general application make it desirable to adjust the properties of this crystallization module in a manner that facilitates its use for RNA structure determination, such as ease of purification, surface entropy or binding affinity. In this work, we used both in vitro RNA selection and phage display selection to alter the epitope and paratope sides of the binding interface, respectively, for improved binding affinity. We identified a 5'-GNGACCC-3' consensus motif in the RNA and S97N mutation in complimentarity determining region L3 of the Fab that independently impart about an order of magnitude improvement in affinity, resulting from new hydrogen bonding interactions. Using a model RNA, these modifications facilitated crystallization under a wider range of conditions and improved diffraction. The improved features of the Fab-RNA module may facilitate its use as an affinity tag for RNA purification and imaging and as a chaperone for RNA crystallography.
G4 notes
2 G-tetrads, 1 G4 helix, 1 G4 stem, UUDD, anti-parallel:basket2, 2+2, 2(-PD+P)

Cartoon-block schematics in six views (download the tarball)

PyMOL session file

Download PDB file

View in 3Dmol.js

List of 2 G-tetrads

 1 glyco-bond=--s- sugar=-3-- groove=-wn- planarity=0.155 type=planar N+ nts=4 GGGG R.G22,R.G26,R.G61,R.G57
 2 glyco-bond=--ss sugar=-3-3 groove=-w-n planarity=0.201 type=other  N+ nts=4 GGGG R.G23,R.G27,R.G59,R.G54

List of 1 G4-helix

In DSSR, a G4-helix is defined by stacking interactions of G-tetrads, regardless of backbone connectivity, and may contain more than one G4-stem.

Helix#1, 2 G-tetrads, INTRA-molecular, with 1 stem
 1  glyco-bond=--s- sugar=-3-- groove=-wn- WC-->Major N+ nts=4 GGGG R.G22,R.G26,R.G61,R.G57
 2  glyco-bond=--ss sugar=-3-3 groove=-w-n WC-->Major N+ nts=4 GGGG R.G23,R.G27,R.G59,R.G54
  step#1  pm(>>,forward)  area=13.44 rise=3.27 twist=35.7
  strand#1 RNA glyco-bond=-- sugar=-- nts=2 GG R.G22,R.G23
  strand#2 RNA glyco-bond=-- sugar=33 nts=2 GG R.G26,R.G27
  strand#3 RNA glyco-bond=ss sugar=-- nts=2 GG R.G61,R.G59
  strand#4 RNA glyco-bond=-s sugar=-3 nts=2 GG R.G57,R.G54

Download PDB file
Interactive view in 3Dmol.js

1 stacking diagram
 1  glyco-bond=--s- sugar=-3-- groove=-wn- WC-->Major N+ nts=4 GGGG R.G22,R.G26,R.G61,R.G57
2 glyco-bond=--ss sugar=-3-3 groove=-w-n WC-->Major N+ nts=4 GGGG R.G23,R.G27,R.G59,R.G54
step#1 pm(>>,forward) area=13.44 rise=3.27 twist=35.7

Download PDB file
Interactive view in 3Dmol.js

List of 1 G4-stem

In DSSR, a G4-stem is defined as a G4-helix with backbone connectivity. Bulges are also allowed along each of the four strands.

Stem#1, 2 G-tetrads, 3 loops, INTRA-molecular, UUDD, anti-parallel:basket2, 2+2, 2(-PD+P)
 1  glyco-bond=--s- sugar=-3-- groove=-wn- WC-->Major N+ nts=4 GGGG R.G22,R.G26,R.G61,R.G57
 2  glyco-bond=--ss sugar=-3-3 groove=-w-n WC-->Major N+ nts=4 GGGG R.G23,R.G27,R.G59,R.G54
  step#1  pm(>>,forward)  area=13.44 rise=3.27 twist=35.7
  strand#1  U RNA glyco-bond=-- sugar=-- nts=2 GG R.G22,R.G23
  strand#2  U RNA glyco-bond=-- sugar=33 nts=2 GG R.G26,R.G27
  strand#3* D RNA glyco-bond=ss sugar=-- nts=2 GG R.G61,R.G59 bulged-nts=1 U R.U60
  strand#4* D RNA glyco-bond=-s sugar=-3 nts=2 GG R.G57,R.G54 bulged-nts=2 AU R.A56,R.U55
  loop#1 type=propeller strands=[#1,#2] nts=2 AC R.A24,R.C25
  loop#2 type=diagonal  strands=[#2,#4] nts=26 GUCCAGUGCGAGACCCGCACUGUUGA R.G28,R.U29,R.C30,R.C31,R.A32,R.G33,R.U34,R.G35,R.C36,R.G37,R.A38,R.G39,R.A40,R.C41,R.C42,R.C43,R.G44,R.C45,R.A46,R.C47,R.U48,R.G49,R.U50,R.U51,R.G52,R.A53
  loop#3 type=propeller strands=[#4,#3] nts=1 A R.A58

Download PDB file
Interactive view in 3Dmol.js