Summary information and primary citation

PDB-id
7l0z
Class
RNA
Method
X-ray (2.1 Å)
Summary
Spinach variant bound to dfhbi-1t
Reference
Jeng SCY, Trachman III RJ, Weissenboeck F, Truong L, Link KA, Jepsen MDE, Knutson JR, Andersen ES, Ferre-D'Amare AR, Unrau PJ (2021): "Fluorogenic aptamers resolve the flexibility of RNA junctions using orientation-dependent FRET." Rna, 27, 433-444. doi: 10.1261/rna.078220.120.
Abstract
To further understand the transcriptome, new tools capable of measuring folding, interactions, and localization of RNA are needed. Although Förster resonance energy transfer (FRET) is an angle- and distance-dependent phenomenon, the majority of FRET measurements have been used to report distances, by assuming rotationally averaged donor-acceptor pairs. Angle-dependent FRET measurements have proven challenging for nucleic acids due to the difficulties in incorporating fluorophores rigidly into local substructures in a biocompatible manner. Fluorescence turn-on RNA aptamers are genetically encodable tags that appear to rigidly confine their cognate fluorophores, and thus have the potential to report angular-resolved FRET. Here, we use the fluorescent aptamers Broccoli and Mango-III as donor and acceptor, respectively, to measure the angular dependence of FRET. Joining the two fluorescent aptamers by a helix of variable length allowed systematic rotation of the acceptor fluorophore relative to the donor. FRET oscillated in a sinusoidal manner as a function of helix length, consistent with simulated data generated from models of oriented fluorophores separated by an inflexible helix. Analysis of the orientation dependence of FRET allowed us to demonstrate structural rigidification of the NiCo riboswitch upon transition metal-ion binding. This application of fluorescence turn-on aptamers opens the way to improved structural interpretation of ensemble and single-molecule FRET measurements of RNA.
G4 notes
2 G-tetrads, 1 G4 helix, 1 G4 stem, UUDD, anti-parallel:basket2, 2+2, 2(-PD+P)

Cartoon-block schematics in six views (download the tarball)

PyMOL session file

Download PDB file

View in 3Dmol.js

List of 2 G-tetrads

 1 glyco-bond=--s- sugar=-33. groove=-wn- planarity=0.318 type=other  N+ nts=4 GGGG G.G15,G.G19,G.G53,G.G49
 2 glyco-bond=--ss sugar=-3-3 groove=-w-n planarity=0.159 type=planar N+ nts=4 GGGG G.G16,G.G20,G.G51,G.G46

List of 1 G4-helix

In DSSR, a G4-helix is defined by stacking interactions of G-tetrads, regardless of backbone connectivity, and may contain more than one G4-stem.

Helix#1, 2 G-tetrads, INTRA-molecular, with 1 stem
 1  glyco-bond=--s- sugar=-33. groove=-wn- WC-->Major N+ nts=4 GGGG G.G15,G.G19,G.G53,G.G49
 2  glyco-bond=--ss sugar=-3-3 groove=-w-n WC-->Major N+ nts=4 GGGG G.G16,G.G20,G.G51,G.G46
  step#1  pm(>>,forward)  area=9.57  rise=3.35 twist=33.6
  strand#1 RNA glyco-bond=-- sugar=-- nts=2 GG G.G15,G.G16
  strand#2 RNA glyco-bond=-- sugar=33 nts=2 GG G.G19,G.G20
  strand#3 RNA glyco-bond=ss sugar=3- nts=2 GG G.G53,G.G51
  strand#4 RNA glyco-bond=-s sugar=.3 nts=2 GG G.G49,G.G46

Download PDB file
Interactive view in 3Dmol.js
1 stacking diagram 
 1  glyco-bond=--s- sugar=-33. groove=-wn- WC-->Major N+ nts=4 GGGG G.G15,G.G19,G.G53,G.G49
 2  glyco-bond=--ss sugar=-3-3 groove=-w-n WC-->Major N+ nts=4 GGGG G.G16,G.G20,G.G51,G.G46
  step#1  pm(>>,forward)  area=9.57  rise=3.35 twist=33.6

Download PDB file
Interactive view in 3Dmol.js

List of 1 G4-stem

In DSSR, a G4-stem is defined as a G4-helix with backbone connectivity. Bulges are also allowed along each of the four strands.

Stem#1, 2 G-tetrads, 3 loops, INTRA-molecular, UUDD, anti-parallel:basket2, 2+2, 2(-PD+P)
 1  glyco-bond=--s- sugar=-33. groove=-wn- WC-->Major N+ nts=4 GGGG G.G15,G.G19,G.G53,G.G49
 2  glyco-bond=--ss sugar=-3-3 groove=-w-n WC-->Major N+ nts=4 GGGG G.G16,G.G20,G.G51,G.G46
  step#1  pm(>>,forward)  area=9.57  rise=3.35 twist=33.6
  strand#1  U RNA glyco-bond=-- sugar=-- nts=2 GG G.G15,G.G16
  strand#2  U RNA glyco-bond=-- sugar=33 nts=2 GG G.G19,G.G20
  strand#3* D RNA glyco-bond=ss sugar=3- nts=2 GG G.G53,G.G51 bulged-nts=1 U G.U52
  strand#4* D RNA glyco-bond=-s sugar=.3 nts=2 GG G.G49,G.G46 bulged-nts=2 AU G.A48,G.U47
  loop#1 type=propeller strands=[#1,#2] nts=2 UC G.U17,G.C18
  loop#2 type=diagonal  strands=[#2,#4] nts=25 GUCCAGUAGGUACGCCUACUGUUGA G.G21,G.U22,G.C23,G.C24,G.A25,G.G26,G.U27,G.A28,G.G29,G.G30,G.U31,G.A32,G.C33,G.G34,G.C35,G.C36,G.U37,G.A38,G.C39,G.U40,G.G41,G.U42,G.U43,G.G44,G.A45
  loop#3 type=propeller strands=[#4,#3] nts=1 A G.A50

Download PDB file
Interactive view in 3Dmol.js