DSSR-enabled G4 identification/annotation: PDB entry 8k7w
Summary information and primary citation
- PDB-id
- 8k7w
- Class
- RNA
- Method
- X-ray (2.24 Å)
- Summary
- Crystal structure of broccoli aptamer with dfhbi-1t
- Reference
- Ren Y, Lin X, Liao W, Peng X, Deng J, Zhang Z, Zhan J, Zhou Y, Westhof E, Lilley DMJ, Wang J, Huang L (2025): "A general strategy for engineering GU base pairs to facilitate RNA crystallization." Nucleic Acids Res., 53. doi: 10.1093/nar/gkae1218.
- Abstract
- X-ray crystallography is a fundamental technique that provides atomic-level insights into RNA structures. However, obtaining crystals of RNA structures diffracting to high resolution is challenging. We introduce a simple strategy to enhance the resolution limit of RNA crystals by the selective substitution of Watson-Crick pairs by GU pairs within RNA sequences. Our approach has successfully yielded high-resolution structures for eight unique RNA crystals. Notably, six instances showed marked resolution enhancement upon GC/AU to GU base pair substitution, with two cases achieving high-resolution structures from initially poor data. In one case, reverting GU to GC base pairs also improved resolution. Our method facilitated the first structural determinations of the Long Interspersed Nuclear Element-1 and Olfactory Receptor family 4 subfamily K member 15 ribozymes, the 2'-deoxyguanosine-III riboswitch and the Broccoli RNA aptamer. The placement of GU base pairs within the first 5' helical stem of any given RNA species, or in one peripheral stem, is shown to be sufficient. These results offer a simple and effective approach for designing sequences or selecting sequences from homologous sequences, for high-resolution RNA structure determination.
- G4 notes
- 4 G-tetrads, 2 G4 helices, 2 G4 stems, UUDD, anti-parallel:basket2, 2+2, 2(-PD+P)
Cartoon-block schematics in six views (download the tarball)
List of 4 G-tetrads
1 glyco-bond=--s- sugar=-33. groove=-wn- planarity=0.316 type=other N+ nts=4 GGGG 1:A.G6,1:A.G10,1:A.G42,1:A.G38 2 glyco-bond=--ss sugar=-3-3 groove=-w-n planarity=0.153 type=planar N+ nts=4 GGGG 1:A.G7,1:A.G11,1:A.G40,1:A.G35 3 glyco-bond=--s- sugar=-33. groove=-wn- planarity=0.316 type=other N+ nts=4 GGGG 2:A.G6,2:A.G10,2:A.G42,2:A.G38 4 glyco-bond=--ss sugar=-3-3 groove=-w-n planarity=0.153 type=planar N+ nts=4 GGGG 2:A.G7,2:A.G11,2:A.G40,2:A.G35
List of 2 G4-helices
In DSSR, a G4-helix is defined by stacking interactions of G-tetrads, regardless of backbone connectivity, and may contain more than one G4-stem.
Helix#1, 2 G-tetrads, INTRA-molecular, with 1 stem
|
1 glyco-bond=--s- sugar=-33. groove=-wn- WC-->Major N+ nts=4 GGGG 1:A.G6,1:A.G10,1:A.G42,1:A.G38 2 glyco-bond=--ss sugar=-3-3 groove=-w-n WC-->Major N+ nts=4 GGGG 1:A.G7,1:A.G11,1:A.G40,1:A.G35 step#1 pm(>>,forward) area=9.24 rise=3.31 twist=33.1 strand#1 RNA glyco-bond=-- sugar=-- nts=2 GG 1:A.G6,1:A.G7 strand#2 RNA glyco-bond=-- sugar=33 nts=2 GG 1:A.G10,1:A.G11 strand#3 RNA glyco-bond=ss sugar=3- nts=2 GG 1:A.G42,1:A.G40 strand#4 RNA glyco-bond=-s sugar=.3 nts=2 GG 1:A.G38,1:A.G35 |
| 1 stacking diagram | |
|
1 glyco-bond=--s- sugar=-33. groove=-wn- WC-->Major N+ nts=4 GGGG 1:A.G6,1:A.G10,1:A.G42,1:A.G38 |
Helix#2, 2 G-tetrads, INTRA-molecular, with 1 stem
|
1 glyco-bond=--s- sugar=-33. groove=-wn- WC-->Major N+ nts=4 GGGG 2:A.G6,2:A.G10,2:A.G42,2:A.G38 2 glyco-bond=--ss sugar=-3-3 groove=-w-n WC-->Major N+ nts=4 GGGG 2:A.G7,2:A.G11,2:A.G40,2:A.G35 step#1 pm(>>,forward) area=9.24 rise=3.31 twist=33.1 strand#1 RNA glyco-bond=-- sugar=-- nts=2 GG 2:A.G6,2:A.G7 strand#2 RNA glyco-bond=-- sugar=33 nts=2 GG 2:A.G10,2:A.G11 strand#3 RNA glyco-bond=ss sugar=3- nts=2 GG 2:A.G42,2:A.G40 strand#4 RNA glyco-bond=-s sugar=.3 nts=2 GG 2:A.G38,2:A.G35 |
| 1 stacking diagram | |
|
1 glyco-bond=--s- sugar=-33. groove=-wn- WC-->Major N+ nts=4 GGGG 2:A.G6,2:A.G10,2:A.G42,2:A.G38 |
List of 2 G4-stems
In DSSR, a G4-stem is defined as a G4-helix with backbone connectivity. Bulges are also allowed along each of the four strands.
Stem#1, 2 G-tetrads, 3 loops, INTRA-molecular, UUDD, anti-parallel:basket2, 2+2, 2(-PD+P)
|
1 glyco-bond=--s- sugar=-33. groove=-wn- WC-->Major N+ nts=4 GGGG 1:A.G6,1:A.G10,1:A.G42,1:A.G38 2 glyco-bond=--ss sugar=-3-3 groove=-w-n WC-->Major N+ nts=4 GGGG 1:A.G7,1:A.G11,1:A.G40,1:A.G35 step#1 pm(>>,forward) area=9.24 rise=3.31 twist=33.1 strand#1 U RNA glyco-bond=-- sugar=-- nts=2 GG 1:A.G6,1:A.G7 strand#2 U RNA glyco-bond=-- sugar=33 nts=2 GG 1:A.G10,1:A.G11 strand#3* D RNA glyco-bond=ss sugar=3- nts=2 GG 1:A.G42,1:A.G40 bulged-nts=1 U 1:A.U41 strand#4* D RNA glyco-bond=-s sugar=.3 nts=2 GG 1:A.G38,1:A.G35 bulged-nts=2 AU 1:A.A37,1:A.U36 loop#1 type=propeller strands=[#1,#2] nts=2 UC 1:A.U8,1:A.C9 loop#2 type=diagonal strands=[#2,#4] nts=23 GUCCAGAUAUUCGUAUCUGUCGA 1:A.G12,1:A.U13,1:A.C14,1:A.C15,1:A.A16,1:A.G17,1:A.A18,1:A.U19,1:A.A20,1:A.U21,1:A.U22,1:A.C23,1:A.G24,1:A.U25,1:A.A26,1:A.U27,1:A.C28,1:A.U29,1:A.G30,1:A.U31,1:A.C32,1:A.G33,1:A.A34 loop#3 type=propeller strands=[#4,#3] nts=1 A 1:A.A39 |
Stem#2, 2 G-tetrads, 3 loops, INTRA-molecular, UUDD, anti-parallel:basket2, 2+2, 2(-PD+P)
|
1 glyco-bond=--s- sugar=-33. groove=-wn- WC-->Major N+ nts=4 GGGG 2:A.G6,2:A.G10,2:A.G42,2:A.G38 2 glyco-bond=--ss sugar=-3-3 groove=-w-n WC-->Major N+ nts=4 GGGG 2:A.G7,2:A.G11,2:A.G40,2:A.G35 step#1 pm(>>,forward) area=9.24 rise=3.31 twist=33.1 strand#1 U RNA glyco-bond=-- sugar=-- nts=2 GG 2:A.G6,2:A.G7 strand#2 U RNA glyco-bond=-- sugar=33 nts=2 GG 2:A.G10,2:A.G11 strand#3* D RNA glyco-bond=ss sugar=3- nts=2 GG 2:A.G42,2:A.G40 bulged-nts=1 U 2:A.U41 strand#4* D RNA glyco-bond=-s sugar=.3 nts=2 GG 2:A.G38,2:A.G35 bulged-nts=2 AU 2:A.A37,2:A.U36 loop#1 type=propeller strands=[#1,#2] nts=2 UC 2:A.U8,2:A.C9 loop#2 type=diagonal strands=[#2,#4] nts=23 GUCCAGAUAUUCGUAUCUGUCGA 2:A.G12,2:A.U13,2:A.C14,2:A.C15,2:A.A16,2:A.G17,2:A.A18,2:A.U19,2:A.A20,2:A.U21,2:A.U22,2:A.C23,2:A.G24,2:A.U25,2:A.A26,2:A.U27,2:A.C28,2:A.U29,2:A.G30,2:A.U31,2:A.C32,2:A.G33,2:A.A34 loop#3 type=propeller strands=[#4,#3] nts=1 A 2:A.A39 |