Summary information and primary citation

PDB-id
9hrf
Class
RNA
Method
X-ray (1.6 Å)
Summary
Crystal structure of the class v (uu) gtp aptamer variant in complex with gtp
Reference
Stafflinger H, Neissner K, Bartsch S, Pichler AK, Bartosik K, Dhamotharan K, Abele R, Duchardt-Ferner E, Micura R, Schindelin H, Wohnert J (2025): "Crystal structure of the class V GTP-binding RNA aptamer bound to its ligand: GTP recognition by a topologically complex intermolecular G-quadruplex." Nucleic Acids Res., 53. doi: 10.1093/nar/gkaf1315.
Abstract
Nucleic acids can adopt a wide variety of different three-dimensional shapes besides the iconic double helical structures. For example, nucleic acid sequences enriched in one of the four building blocks – guanosine – often adopt so-called G-quadruplex structures. There, four guanosine nucleotides are arranged in a cyclic array connected by hydrogen bonds and multiple of these G-tetrades are stacked on top of each other. Here, we present the structure of a synthetic RNA that forms a G-quadruplex not from a G-rich sequence motif but by bringing together G-nucleotides far apart in sequence by adopting a complex three-dimensional structure and by incorporating GTP as a ligand. Our structure suggests that G-quadruplexes might be more widespread in biologically important RNAs then previously assumed.
G4 notes
2 G-tetrads, 1 G4 helix

Cartoon-block schematics in six views (download the tarball)

PyMOL session file

Download PDB file

View in 3Dmol.js

List of 2 G-tetrads

 1 glyco-bond=---- sugar=---3 groove=---- planarity=0.314 type=other  Z- nts=4 GgGG A.G12,A.GTP100,A.G42,A.G46
 2 glyco-bond=-s-- sugar=-3-3 groove=wn-- planarity=0.277 type=other  O+ nts=4 GGGG A.G13,A.G40,A.G43,A.G47

List of 1 G4-helix

In DSSR, a G4-helix is defined by stacking interactions of G-tetrads, regardless of backbone connectivity, and may contain more than one G4-stem.

Helix#1, 2 G-tetrads, INTRA-molecular
 1  glyco-bond=---- sugar=---3 groove=---- WC-->Major Z- nts=4 GgGG A.G12,A.GTP100,A.G42,A.G46
 2  glyco-bond=-s-- sugar=-3-3 groove=wn-- WC-->Major O+ nts=4 GGGG A.G13,A.G40,A.G43,A.G47
  step#1  pm(>>,forward)  area=7.84  rise=3.35 twist=32.6
  strand#1 RNA glyco-bond=-- sugar=-- nts=2 GG A.G12,A.G13
  strand#2 RNA glyco-bond=-s sugar=-3 nts=2 gG A.GTP100,A.G40
  strand#3 RNA glyco-bond=-- sugar=-- nts=2 GG A.G42,A.G43
  strand#4 RNA glyco-bond=-- sugar=33 nts=2 GG A.G46,A.G47

Download PDB file
Interactive view in 3Dmol.js
1 stacking diagram 
 1  glyco-bond=---- sugar=---3 groove=---- WC-->Major Z- nts=4 GgGG A.G12,A.GTP100,A.G42,A.G46
 2  glyco-bond=-s-- sugar=-3-3 groove=wn-- WC-->Major O+ nts=4 GGGG A.G13,A.G40,A.G43,A.G47
  step#1  pm(>>,forward)  area=7.84  rise=3.35 twist=32.6

Download PDB file
Interactive view in 3Dmol.js

List of 2 non-stem G4-loops (including the two closing Gs)

 1 type=lateral   helix=#1 nts=28 GUAGGUCGGUCGCUGCUUCGGCAGUGAG A.G13,A.U14,A.A15,A.G16,A.G17,A.U18,A.C19,A.G20,A.G21,A.U22,A.C23,A.G24,A.C25,A.U26,A.G27,A.C28,A.U29,A.U30,A.C31,A.G32,A.G33,A.C34,A.A35,A.G36,A.U37,A.G38,A.A39,A.G40
 2 type=V-shaped  helix=#1 nts=4 GGGG A.G40,A.G41,A.G42,A.G43