Summary information and primary citation

PDB-id
9hrg
Class
RNA
Method
X-ray (2.05 Å)
Summary
Crystal structure of the class v (g61a) gtp aptamer variant in complex with gtp
Reference
Stafflinger H, Neissner K, Bartsch S, Pichler AK, Bartosik K, Dhamotharan K, Abele R, Duchardt-Ferner E, Micura R, Schindelin H, Wohnert J (2025): "Crystal structure of the class V GTP-binding RNA aptamer bound to its ligand: GTP recognition by a topologically complex intermolecular G-quadruplex." Nucleic Acids Res., 53. doi: 10.1093/nar/gkaf1315.
Abstract
Nucleic acids can adopt a wide variety of different three-dimensional shapes besides the iconic double helical structures. For example, nucleic acid sequences enriched in one of the four building blocks – guanosine – often adopt so-called G-quadruplex structures. There, four guanosine nucleotides are arranged in a cyclic array connected by hydrogen bonds and multiple of these G-tetrades are stacked on top of each other. Here, we present the structure of a synthetic RNA that forms a G-quadruplex not from a G-rich sequence motif but by bringing together G-nucleotides far apart in sequence by adopting a complex three-dimensional structure and by incorporating GTP as a ligand. Our structure suggests that G-quadruplexes might be more widespread in biologically important RNAs then previously assumed.
G4 notes
4 G-tetrads, 2 G4 helices

Cartoon-block schematics in six views (download the tarball)

PyMOL session file

Download PDB file

View in 3Dmol.js

List of 4 G-tetrads

 1 glyco-bond=---- sugar=---3 groove=---- planarity=0.403 type=bowl-2 Z- nts=4 GgGG 1:A.G12,1:A.GTP103,1:A.G42,1:A.G46
 2 glyco-bond=-s-- sugar=-3-3 groove=wn-- planarity=0.327 type=bowl   O+ nts=4 GGGG 1:A.G13,1:A.G40,1:A.G43,1:A.G47
 3 glyco-bond=---- sugar=---3 groove=---- planarity=0.397 type=bowl-2 Z- nts=4 GgGG 1:B.G12,1:B.GTP103,1:B.G42,1:B.G46
 4 glyco-bond=-s-- sugar=-3-3 groove=wn-- planarity=0.313 type=bowl   O+ nts=4 GGGG 1:B.G13,1:B.G40,1:B.G43,1:B.G47

List of 2 G4-helices

In DSSR, a G4-helix is defined by stacking interactions of G-tetrads, regardless of backbone connectivity, and may contain more than one G4-stem.

Helix#1, 2 G-tetrads, INTRA-molecular
 1  glyco-bond=---- sugar=---3 groove=---- WC-->Major Z- nts=4 GgGG 1:A.G12,1:A.GTP103,1:A.G42,1:A.G46
 2  glyco-bond=-s-- sugar=-3-3 groove=wn-- WC-->Major O+ nts=4 GGGG 1:A.G13,1:A.G40,1:A.G43,1:A.G47
  step#1  pm(>>,forward)  area=10.11 rise=3.38 twist=31.1
  strand#1 RNA glyco-bond=-- sugar=-- nts=2 GG 1:A.G12,1:A.G13
  strand#2 RNA glyco-bond=-s sugar=-3 nts=2 gG 1:A.GTP103,1:A.G40
  strand#3 RNA glyco-bond=-- sugar=-- nts=2 GG 1:A.G42,1:A.G43
  strand#4 RNA glyco-bond=-- sugar=33 nts=2 GG 1:A.G46,1:A.G47

Download PDB file
Interactive view in 3Dmol.js
1 stacking diagram 
 1  glyco-bond=---- sugar=---3 groove=---- WC-->Major Z- nts=4 GgGG 1:A.G12,1:A.GTP103,1:A.G42,1:A.G46
 2  glyco-bond=-s-- sugar=-3-3 groove=wn-- WC-->Major O+ nts=4 GGGG 1:A.G13,1:A.G40,1:A.G43,1:A.G47
  step#1  pm(>>,forward)  area=10.11 rise=3.38 twist=31.1

Download PDB file
Interactive view in 3Dmol.js
Helix#2, 2 G-tetrads, INTRA-molecular
 1  glyco-bond=---- sugar=---3 groove=---- WC-->Major Z- nts=4 GgGG 1:B.G12,1:B.GTP103,1:B.G42,1:B.G46
 2  glyco-bond=-s-- sugar=-3-3 groove=wn-- WC-->Major O+ nts=4 GGGG 1:B.G13,1:B.G40,1:B.G43,1:B.G47
  step#1  pm(>>,forward)  area=9.89  rise=3.36 twist=31.1
  strand#1 RNA glyco-bond=-- sugar=-- nts=2 GG 1:B.G12,1:B.G13
  strand#2 RNA glyco-bond=-s sugar=-3 nts=2 gG 1:B.GTP103,1:B.G40
  strand#3 RNA glyco-bond=-- sugar=-- nts=2 GG 1:B.G42,1:B.G43
  strand#4 RNA glyco-bond=-- sugar=33 nts=2 GG 1:B.G46,1:B.G47

Download PDB file
Interactive view in 3Dmol.js
1 stacking diagram 
 1  glyco-bond=---- sugar=---3 groove=---- WC-->Major Z- nts=4 GgGG 1:B.G12,1:B.GTP103,1:B.G42,1:B.G46
 2  glyco-bond=-s-- sugar=-3-3 groove=wn-- WC-->Major O+ nts=4 GGGG 1:B.G13,1:B.G40,1:B.G43,1:B.G47
  step#1  pm(>>,forward)  area=9.89  rise=3.36 twist=31.1

Download PDB file
Interactive view in 3Dmol.js

List of 4 non-stem G4-loops (including the two closing Gs)

 1 type=lateral   helix=#1 nts=28 GUAGGUCGGUCGCUGCUUCGGCAGUGAG 1:A.G13,1:A.U14,1:A.A15,1:A.G16,1:A.G17,1:A.U18,1:A.C19,1:A.G20,1:A.G21,1:A.U22,1:A.C23,1:A.G24,1:A.C25,1:A.U26,1:A.G27,1:A.C28,1:A.U29,1:A.U30,1:A.C31,1:A.G32,1:A.G33,1:A.C34,1:A.A35,1:A.G36,1:A.U37,1:A.G38,1:A.A39,1:A.G40
 2 type=V-shaped  helix=#1 nts=4 GGGG 1:A.G40,1:A.G41,1:A.G42,1:A.G43
 3 type=lateral   helix=#2 nts=28 GUAGGUCGGUCGCUGCUUCGGCAGUGAG 1:B.G13,1:B.U14,1:B.A15,1:B.G16,1:B.G17,1:B.U18,1:B.C19,1:B.G20,1:B.G21,1:B.U22,1:B.C23,1:B.G24,1:B.C25,1:B.U26,1:B.G27,1:B.C28,1:B.U29,1:B.U30,1:B.C31,1:B.G32,1:B.G33,1:B.C34,1:B.A35,1:B.G36,1:B.U37,1:B.G38,1:B.A39,1:B.G40
 4 type=V-shaped  helix=#2 nts=4 GGGG 1:B.G40,1:B.G41,1:B.G42,1:B.G43