Summary information and primary citation

PDB-id
9vmz
Class
RNA
Method
X-ray (2.44 Å)
Summary
Crystal structure of broccoli aptamer in with bi
Reference
Peng X, Huang L: "Crystal structure of Broccoli aptamer in with BI."
Abstract
 
G4 notes
4 G-tetrads, 2 G4 helices, 2 G4 stems, UUDD, anti-parallel:basket2, 2+2, 2(-PD+P)

Cartoon-block schematics in six views (download the tarball)

PyMOL session file

Download PDB file

View in 3Dmol.js

List of 4 G-tetrads

 1 glyco-bond=--s- sugar=-333 groove=-wn- planarity=0.339 type=other  N+ nts=4 GGGG 1:A.G6,1:A.G10,1:A.G42,1:A.G38
 2 glyco-bond=--ss sugar=-3-3 groove=-w-n planarity=0.184 type=other  N+ nts=4 GGGG 1:A.G7,1:A.G11,1:A.G40,1:A.G35
 3 glyco-bond=--s- sugar=-333 groove=-wn- planarity=0.339 type=other  N+ nts=4 GGGG 1:A-2.G6,1:A-2.G10,1:A-2.G42,1:A-2.G38
 4 glyco-bond=--ss sugar=-3-3 groove=-w-n planarity=0.184 type=other  N+ nts=4 GGGG 1:A-2.G7,1:A-2.G11,1:A-2.G40,1:A-2.G35

List of 2 G4-helices

In DSSR, a G4-helix is defined by stacking interactions of G-tetrads, regardless of backbone connectivity, and may contain more than one G4-stem.

Helix#1, 2 G-tetrads, INTRA-molecular, with 1 stem
 1  glyco-bond=--s- sugar=-333 groove=-wn- WC-->Major N+ nts=4 GGGG 1:A.G6,1:A.G10,1:A.G42,1:A.G38
 2  glyco-bond=--ss sugar=-3-3 groove=-w-n WC-->Major N+ nts=4 GGGG 1:A.G7,1:A.G11,1:A.G40,1:A.G35
  step#1  pm(>>,forward)  area=9.75  rise=3.22 twist=32.0
  strand#1 RNA glyco-bond=-- sugar=-- nts=2 GG 1:A.G6,1:A.G7
  strand#2 RNA glyco-bond=-- sugar=33 nts=2 GG 1:A.G10,1:A.G11
  strand#3 RNA glyco-bond=ss sugar=3- nts=2 GG 1:A.G42,1:A.G40
  strand#4 RNA glyco-bond=-s sugar=33 nts=2 GG 1:A.G38,1:A.G35

Download PDB file
Interactive view in 3Dmol.js
1 stacking diagram 
 1  glyco-bond=--s- sugar=-333 groove=-wn- WC-->Major N+ nts=4 GGGG 1:A.G6,1:A.G10,1:A.G42,1:A.G38
 2  glyco-bond=--ss sugar=-3-3 groove=-w-n WC-->Major N+ nts=4 GGGG 1:A.G7,1:A.G11,1:A.G40,1:A.G35
  step#1  pm(>>,forward)  area=9.75  rise=3.22 twist=32.0

Download PDB file
Interactive view in 3Dmol.js
Helix#2, 2 G-tetrads, INTRA-molecular, with 1 stem
 1  glyco-bond=--s- sugar=-333 groove=-wn- WC-->Major N+ nts=4 GGGG 1:A-2.G6,1:A-2.G10,1:A-2.G42,1:A-2.G38
 2  glyco-bond=--ss sugar=-3-3 groove=-w-n WC-->Major N+ nts=4 GGGG 1:A-2.G7,1:A-2.G11,1:A-2.G40,1:A-2.G35
  step#1  pm(>>,forward)  area=9.75  rise=3.22 twist=32.0
  strand#1 RNA glyco-bond=-- sugar=-- nts=2 GG 1:A-2.G6,1:A-2.G7
  strand#2 RNA glyco-bond=-- sugar=33 nts=2 GG 1:A-2.G10,1:A-2.G11
  strand#3 RNA glyco-bond=ss sugar=3- nts=2 GG 1:A-2.G42,1:A-2.G40
  strand#4 RNA glyco-bond=-s sugar=33 nts=2 GG 1:A-2.G38,1:A-2.G35

Download PDB file
Interactive view in 3Dmol.js
1 stacking diagram 
 1  glyco-bond=--s- sugar=-333 groove=-wn- WC-->Major N+ nts=4 GGGG 1:A-2.G6,1:A-2.G10,1:A-2.G42,1:A-2.G38
 2  glyco-bond=--ss sugar=-3-3 groove=-w-n WC-->Major N+ nts=4 GGGG 1:A-2.G7,1:A-2.G11,1:A-2.G40,1:A-2.G35
  step#1  pm(>>,forward)  area=9.75  rise=3.22 twist=32.0

Download PDB file
Interactive view in 3Dmol.js

List of 2 G4-stems

In DSSR, a G4-stem is defined as a G4-helix with backbone connectivity. Bulges are also allowed along each of the four strands.

Stem#1, 2 G-tetrads, 3 loops, INTRA-molecular, UUDD, anti-parallel:basket2, 2+2, 2(-PD+P)
 1  glyco-bond=--s- sugar=-333 groove=-wn- WC-->Major N+ nts=4 GGGG 1:A.G6,1:A.G10,1:A.G42,1:A.G38
 2  glyco-bond=--ss sugar=-3-3 groove=-w-n WC-->Major N+ nts=4 GGGG 1:A.G7,1:A.G11,1:A.G40,1:A.G35
  step#1  pm(>>,forward)  area=9.75  rise=3.22 twist=32.0
  strand#1  U RNA glyco-bond=-- sugar=-- nts=2 GG 1:A.G6,1:A.G7
  strand#2  U RNA glyco-bond=-- sugar=33 nts=2 GG 1:A.G10,1:A.G11
  strand#3* D RNA glyco-bond=ss sugar=3- nts=2 GG 1:A.G42,1:A.G40 bulged-nts=1 U 1:A.U41
  strand#4* D RNA glyco-bond=-s sugar=33 nts=2 GG 1:A.G38,1:A.G35 bulged-nts=2 AU 1:A.A37,1:A.U36
  loop#1 type=propeller strands=[#1,#2] nts=2 UC 1:A.U8,1:A.C9
  loop#2 type=diagonal  strands=[#2,#4] nts=23 GUCCAGAUAUUCGUAUCUGUCGA 1:A.G12,1:A.U13,1:A.C14,1:A.C15,1:A.A16,1:A.G17,1:A.A18,1:A.U19,1:A.A20,1:A.U21,1:A.U22,1:A.C23,1:A.G24,1:A.U25,1:A.A26,1:A.U27,1:A.C28,1:A.U29,1:A.G30,1:A.U31,1:A.C32,1:A.G33,1:A.A34
  loop#3 type=propeller strands=[#4,#3] nts=1 A 1:A.A39

Download PDB file
Interactive view in 3Dmol.js
Stem#2, 2 G-tetrads, 3 loops, INTRA-molecular, UUDD, anti-parallel:basket2, 2+2, 2(-PD+P)
 1  glyco-bond=--s- sugar=-333 groove=-wn- WC-->Major N+ nts=4 GGGG 1:A-2.G6,1:A-2.G10,1:A-2.G42,1:A-2.G38
 2  glyco-bond=--ss sugar=-3-3 groove=-w-n WC-->Major N+ nts=4 GGGG 1:A-2.G7,1:A-2.G11,1:A-2.G40,1:A-2.G35
  step#1  pm(>>,forward)  area=9.75  rise=3.22 twist=32.0
  strand#1  U RNA glyco-bond=-- sugar=-- nts=2 GG 1:A-2.G6,1:A-2.G7
  strand#2  U RNA glyco-bond=-- sugar=33 nts=2 GG 1:A-2.G10,1:A-2.G11
  strand#3* D RNA glyco-bond=ss sugar=3- nts=2 GG 1:A-2.G42,1:A-2.G40 bulged-nts=1 U 1:A-2.U41
  strand#4* D RNA glyco-bond=-s sugar=33 nts=2 GG 1:A-2.G38,1:A-2.G35 bulged-nts=2 AU 1:A-2.A37,1:A-2.U36
  loop#1 type=propeller strands=[#1,#2] nts=2 UC 1:A-2.U8,1:A-2.C9
  loop#2 type=diagonal  strands=[#2,#4] nts=23 GUCCAGAUAUUCGUAUCUGUCGA 1:A-2.G12,1:A-2.U13,1:A-2.C14,1:A-2.C15,1:A-2.A16,1:A-2.G17,1:A-2.A18,1:A-2.U19,1:A-2.A20,1:A-2.U21,1:A-2.U22,1:A-2.C23,1:A-2.G24,1:A-2.U25,1:A-2.A26,1:A-2.U27,1:A-2.C28,1:A-2.U29,1:A-2.G30,1:A-2.U31,1:A-2.C32,1:A-2.G33,1:A-2.A34
  loop#3 type=propeller strands=[#4,#3] nts=1 A 1:A-2.A39

Download PDB file
Interactive view in 3Dmol.js